Transcript: Human XM_011524471.1

PREDICTED: Homo sapiens Rho GTPase activating protein 27 (ARHGAP27), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP27 (201176)
Length:
4546
CDS:
401..2998

Additional Resources:

NCBI RefSeq record:
XM_011524471.1
NBCI Gene record:
ARHGAP27 (201176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415191 CCCTCGAAGCATCCATAAATC pLKO_005 1573 CDS 100% 13.200 18.480 N ARHGAP27 n/a
2 TRCN0000454952 TATTCTCCCGTGGGCTCTTTC pLKO_005 1352 CDS 100% 10.800 8.640 N ARHGAP27 n/a
3 TRCN0000048354 CCATCCAGAAGCTACGCTATA pLKO.1 2547 CDS 100% 10.800 7.560 N ARHGAP27 n/a
4 TRCN0000048356 AGACAAATCCAGTAGGAAGAA pLKO.1 1942 CDS 100% 4.950 3.465 N ARHGAP27 n/a
5 TRCN0000048355 CCAGTTCATTGCGGCCATCAA pLKO.1 2695 CDS 100% 4.950 3.465 N ARHGAP27 n/a
6 TRCN0000048353 CGGGAAGCCATACTTCTACAA pLKO.1 1501 CDS 100% 4.950 3.465 N ARHGAP27 n/a
7 TRCN0000423320 GTGGCGTCCTGACATTCTTCA pLKO_005 1815 CDS 100% 4.950 3.465 N ARHGAP27 n/a
8 TRCN0000048357 CAAGCAGATGCTCTACACCAA pLKO.1 1438 CDS 100% 2.640 1.848 N ARHGAP27 n/a
9 TRCN0000417582 CCCTAGTGGGCAGTTTGCAAA pLKO_005 3156 3UTR 100% 4.950 2.970 N ARHGAP27 n/a
10 TRCN0000283798 CTACGACTACCGGTTTGTGAG pLKO_005 676 CDS 100% 4.050 2.430 N ARHGAP27 n/a
11 TRCN0000268801 CTTCTACCTGCCTGCGCAGTA pLKO_005 568 CDS 100% 1.350 0.810 N ARHGAP27 n/a
12 TRCN0000283802 AGCGACTCAGAGAACGTCTAC pLKO_005 986 CDS 100% 4.050 2.025 Y ARHGAP27 n/a
13 TRCN0000268799 TTCGAGTACACCGGCAAGGAC pLKO_005 449 CDS 100% 0.880 0.440 Y ARHGAP27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466675 GTACCCCAGTCATAGTGCGCCCTT pLX_317 22.4% 62.6% 62% V5 (many diffs) n/a
2 ccsbBroadEn_10389 pDONR223 100% 7.5% 7% None (many diffs) n/a
3 ccsbBroad304_10389 pLX_304 0% 7.5% 7% V5 (many diffs) n/a
4 TRCN0000465995 TCCAACACTCCGTGGGTCTAGACT pLX_317 100% 7.5% 7% V5 (many diffs) n/a
Download CSV