Transcript: Human XM_011524473.2

PREDICTED: Homo sapiens Rho GTPase activating protein 27 (ARHGAP27), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP27 (201176)
Length:
2439
CDS:
374..2137

Additional Resources:

NCBI RefSeq record:
XM_011524473.2
NBCI Gene record:
ARHGAP27 (201176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415191 CCCTCGAAGCATCCATAAATC pLKO_005 1717 CDS 100% 13.200 18.480 N ARHGAP27 n/a
2 TRCN0000454952 TATTCTCCCGTGGGCTCTTTC pLKO_005 1496 CDS 100% 10.800 8.640 N ARHGAP27 n/a
3 TRCN0000048356 AGACAAATCCAGTAGGAAGAA pLKO.1 2086 CDS 100% 4.950 3.465 N ARHGAP27 n/a
4 TRCN0000048353 CGGGAAGCCATACTTCTACAA pLKO.1 1645 CDS 100% 4.950 3.465 N ARHGAP27 n/a
5 TRCN0000423320 GTGGCGTCCTGACATTCTTCA pLKO_005 1959 CDS 100% 4.950 3.465 N ARHGAP27 n/a
6 TRCN0000048357 CAAGCAGATGCTCTACACCAA pLKO.1 1582 CDS 100% 2.640 1.848 N ARHGAP27 n/a
7 TRCN0000283798 CTACGACTACCGGTTTGTGAG pLKO_005 649 CDS 100% 4.050 2.430 N ARHGAP27 n/a
8 TRCN0000268801 CTTCTACCTGCCTGCGCAGTA pLKO_005 541 CDS 100% 1.350 0.810 N ARHGAP27 n/a
9 TRCN0000283802 AGCGACTCAGAGAACGTCTAC pLKO_005 959 CDS 100% 4.050 2.025 Y ARHGAP27 n/a
10 TRCN0000268799 TTCGAGTACACCGGCAAGGAC pLKO_005 422 CDS 100% 0.880 0.440 Y ARHGAP27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466675 GTACCCCAGTCATAGTGCGCCCTT pLX_317 22.4% 27.3% 26.8% V5 (many diffs) n/a
2 ccsbBroadEn_10389 pDONR223 100% 11% 10.3% None (many diffs) n/a
3 ccsbBroad304_10389 pLX_304 0% 11% 10.3% V5 (many diffs) n/a
4 TRCN0000465995 TCCAACACTCCGTGGGTCTAGACT pLX_317 100% 11% 10.3% V5 (many diffs) n/a
Download CSV