Transcript: Human XM_011524693.3

PREDICTED: Homo sapiens SAP30 binding protein (SAP30BP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAP30BP (29115)
Length:
2556
CDS:
36..1043

Additional Resources:

NCBI RefSeq record:
XM_011524693.3
NBCI Gene record:
SAP30BP (29115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179157 GACTCCTACTATGAGGCATTA pLKO.1 615 CDS 100% 10.800 15.120 N SAP30BP n/a
2 TRCN0000146889 CCAGAAGCTTTATGAACGAAA pLKO.1 440 CDS 100% 4.950 6.930 N SAP30BP n/a
3 TRCN0000280874 CCAGAAGCTTTATGAACGAAA pLKO_005 440 CDS 100% 4.950 6.930 N SAP30BP n/a
4 TRCN0000180723 GACAGTCGGAAGATGACGATT pLKO.1 244 CDS 100% 4.950 6.930 N SAP30BP n/a
5 TRCN0000280944 GACAGTCGGAAGATGACGATT pLKO_005 244 CDS 100% 4.950 6.930 N SAP30BP n/a
6 TRCN0000099473 GCACCAACTACCCAAAGGATA pLKO.1 568 CDS 100% 4.950 6.930 N Sap30bp n/a
7 TRCN0000180784 GCACCAACTACCCAAAGGATA pLKO.1 568 CDS 100% 4.950 6.930 N SAP30BP n/a
8 TRCN0000280873 GCACCAACTACCCAAAGGATA pLKO_005 568 CDS 100% 4.950 6.930 N SAP30BP n/a
9 TRCN0000312224 GCACCAACTACCCAAAGGATA pLKO_005 568 CDS 100% 4.950 6.930 N Sap30bp n/a
10 TRCN0000180341 GAAATCAAGATCCCGCCAGAA pLKO.1 381 CDS 100% 4.050 5.670 N SAP30BP n/a
11 TRCN0000280876 GAAATCAAGATCCCGCCAGAA pLKO_005 381 CDS 100% 4.050 5.670 N SAP30BP n/a
12 TRCN0000147243 GAAGAAGATGAGAACAGTAGA pLKO.1 225 CDS 100% 4.950 3.465 N SAP30BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03082 pDONR223 100% 91.9% 91.9% None 661_741del n/a
2 ccsbBroad304_03082 pLX_304 0% 91.9% 91.9% V5 661_741del n/a
3 TRCN0000467101 GTCAGCAAGTATGTGTCTGACAGT pLX_317 32% 91.9% 91.9% V5 661_741del n/a
Download CSV