Transcript: Human XM_011525710.2

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type M (PTPRM), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRM (5797)
Length:
5668
CDS:
499..4971

Additional Resources:

NCBI RefSeq record:
XM_011525710.2
NBCI Gene record:
PTPRM (5797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273326 GTCGATTCCACGAGCTATAAA pLKO_005 1495 CDS 100% 15.000 21.000 N PTPRM n/a
2 TRCN0000273327 CAAGACGTTCCATGGTATTTG pLKO_005 5016 3UTR 100% 13.200 18.480 N PTPRM n/a
3 TRCN0000002881 CGACGCTTCATTGCTTCATTT pLKO.1 1213 CDS 100% 13.200 18.480 N PTPRM n/a
4 TRCN0000318666 CGACGCTTCATTGCTTCATTT pLKO_005 1213 CDS 100% 13.200 18.480 N PTPRM n/a
5 TRCN0000379486 GCTATCTGGCATTATGGTAAT pLKO_005 5359 3UTR 100% 10.800 15.120 N PTPRM n/a
6 TRCN0000002880 CCCTCAACACACGATCACTAA pLKO.1 1821 CDS 100% 4.950 6.930 N PTPRM n/a
7 TRCN0000002878 GCCCTCATGGACAGCTATAAA pLKO.1 4348 CDS 100% 15.000 10.500 N PTPRM n/a
8 TRCN0000273324 CATCTTGCTGTTCGTGATTAT pLKO_005 2820 CDS 100% 13.200 9.240 N PTPRM n/a
9 TRCN0000380011 CTATGCAGAGTTGGTAGTTAA pLKO_005 1314 CDS 100% 13.200 9.240 N PTPRM n/a
10 TRCN0000002882 GAGTCGTCGTTTCTGTCAGAT pLKO.1 5486 3UTR 100% 4.950 3.465 N PTPRM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11078 pDONR223 100% 93.1% 93% None (many diffs) n/a
2 ccsbBroad304_11078 pLX_304 0% 93.1% 93% V5 (many diffs) n/a
3 TRCN0000481445 CATTTCGACCGGGCGGCTAGACTT pLX_317 11.2% 93.1% 93% V5 (many diffs) n/a
Download CSV