Transcript: Human XM_011525835.2

PREDICTED: Homo sapiens cytochrome b5 type A (CYB5A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYB5A (1528)
Length:
1308
CDS:
106..402

Additional Resources:

NCBI RefSeq record:
XM_011525835.2
NBCI Gene record:
CYB5A (1528)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064566 ACTCTACAGATGCCAGGGAAA pLKO.1 308 CDS 100% 4.050 3.240 N CYB5A n/a
2 TRCN0000288973 ACTCTACAGATGCCAGGGAAA pLKO_005 308 CDS 100% 4.050 3.240 N CYB5A n/a
3 TRCN0000064565 GCACCACAAGGTGTACGATTT pLKO.1 195 CDS 100% 10.800 7.560 N CYB5A n/a
4 TRCN0000288908 GCACCACAAGGTGTACGATTT pLKO_005 195 CDS 100% 10.800 7.560 N CYB5A n/a
5 TRCN0000064564 CCATCCAGATGACAGACCAAA pLKO.1 357 CDS 100% 4.950 3.465 N CYB5A n/a
6 TRCN0000288974 CCATCCAGATGACAGACCAAA pLKO_005 357 CDS 100% 4.950 3.465 N CYB5A n/a
7 TRCN0000064567 CCTAGAGGAGATTCAGAAGCA pLKO.1 144 CDS 100% 2.640 1.848 N CYB5A n/a
8 TRCN0000288975 CCTAGAGGAGATTCAGAAGCA pLKO_005 144 CDS 100% 2.640 1.848 N CYB5A n/a
9 TRCN0000064563 GCTACTGAGAACTTTGAGGAT pLKO.1 280 CDS 100% 2.640 1.848 N CYB5A n/a
10 TRCN0000288907 GCTACTGAGAACTTTGAGGAT pLKO_005 280 CDS 100% 2.640 1.848 N CYB5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00401 pDONR223 100% 72.8% 72.3% None 292C>A;294_295ins108 n/a
2 ccsbBroad304_00401 pLX_304 0% 72.8% 72.3% V5 292C>A;294_295ins108 n/a
3 TRCN0000475059 GCCACATACAAACGTAGACCTTTA pLX_317 77.7% 72.8% 72.3% V5 292C>A;294_295ins108 n/a
4 TRCN0000488397 AATTGGCTATTAGTACGTGATGGT pLX_317 68.6% 72.8% 72.3% V5 (not translated due to prior stop codon) 292C>A;294_295ins108 n/a
Download CSV