Transcript: Human XM_011525875.2

PREDICTED: Homo sapiens docking protein 6 (DOK6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOK6 (220164)
Length:
8842
CDS:
219..1088

Additional Resources:

NCBI RefSeq record:
XM_011525875.2
NBCI Gene record:
DOK6 (220164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433331 GACATCGTAGCTGCATATAAA pLKO_005 1704 3UTR 100% 15.000 21.000 N DOK6 n/a
2 TRCN0000412540 GATCTATCAGAAGGTTCATTC pLKO_005 872 CDS 100% 10.800 15.120 N DOK6 n/a
3 TRCN0000167115 CGTTGGTGAAATCTACAGTTT pLKO.1 1049 CDS 100% 4.950 6.930 N DOK6 n/a
4 TRCN0000168743 GCGTTGGTGAAATCTACAGTT pLKO.1 1048 CDS 100% 4.950 6.930 N DOK6 n/a
5 TRCN0000417501 TGAGCAACATGAAAGATTAAT pLKO_005 911 CDS 100% 15.000 10.500 N DOK6 n/a
6 TRCN0000168191 CACGTTTGAGTCAGGAAGAAT pLKO.1 800 CDS 100% 5.625 3.938 N DOK6 n/a
7 TRCN0000172959 GCGGGAACAGAATGAGAGATT pLKO.1 614 CDS 100% 4.950 3.465 N DOK6 n/a
8 TRCN0000168378 GCTTGACTGAACCAATGACAT pLKO.1 967 CDS 100% 4.950 3.465 N DOK6 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7866 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13414 pDONR223 100% 54.2% 53.7% None (many diffs) n/a
2 ccsbBroad304_13414 pLX_304 0% 54.2% 53.7% V5 (many diffs) n/a
3 TRCN0000479186 GTAGCTATTCCATAGAGCGTCGGG pLX_317 62.9% 54.2% 53.7% V5 (many diffs) n/a
Download CSV