Transcript: Human XM_011526131.1

PREDICTED: Homo sapiens RAB27B, member RAS oncogene family (RAB27B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB27B (5874)
Length:
2090
CDS:
522..1070

Additional Resources:

NCBI RefSeq record:
XM_011526131.1
NBCI Gene record:
RAB27B (5874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293979 GACGCCATGGGCTTCTTATTA pLKO_005 792 CDS 100% 15.000 21.000 N RAB27B n/a
2 TRCN0000047688 CCCAAATTCATCACTACAGTA pLKO.1 627 CDS 100% 4.950 6.930 N RAB27B n/a
3 TRCN0000382413 TCGGGAACTGGCTGACAAATA pLKO_005 965 CDS 100% 13.200 10.560 N RAB27B n/a
4 TRCN0000293978 CCAGTCAACAGAGCTTCTTAA pLKO_005 826 CDS 100% 13.200 9.240 N RAB27B n/a
5 TRCN0000380904 CAGATCAGAGGGAAGTCAATG pLKO_005 934 CDS 100% 10.800 7.560 N RAB27B n/a
6 TRCN0000047691 GCCAACTGCAAGCAAATGCTT pLKO.1 865 CDS 100% 3.000 2.100 N RAB27B n/a
7 TRCN0000286658 GCCAACTGCAAGCAAATGCTT pLKO_005 865 CDS 100% 3.000 2.100 N RAB27B n/a
8 TRCN0000047692 GTAGGAATAGACTTTCGGGAA pLKO.1 645 CDS 100% 2.160 1.512 N RAB27B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01362 pDONR223 100% 78.4% 73.8% None (many diffs) n/a
2 ccsbBroad304_01362 pLX_304 0% 78.4% 73.8% V5 (many diffs) n/a
3 TRCN0000470827 GAGCAAGATAAGCATAAGCAACTA pLX_317 59.4% 78.4% 73.8% V5 (many diffs) n/a
Download CSV