Transcript: Human XM_011526150.2

PREDICTED: Homo sapiens SS18 subunit of BAF chromatin remodeling complex (SS18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SS18 (6760)
Length:
2480
CDS:
358..1458

Additional Resources:

NCBI RefSeq record:
XM_011526150.2
NBCI Gene record:
SS18 (6760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526150.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337696 TGAGGATTCCTCACAACATTA pLKO_005 1143 CDS 100% 13.200 18.480 N Ss18 n/a
2 TRCN0000337697 GTTATCAGCAACCGTCGTATC pLKO_005 1097 CDS 100% 6.000 8.400 N Ss18 n/a
3 TRCN0000304836 TCCTGAACAAGGCTACGATAG pLKO_005 1116 CDS 100% 6.000 8.400 N Ss18 n/a
4 TRCN0000108562 TGGTCATAATGATTACGGTTA pLKO.1 1080 CDS 100% 4.050 5.670 N Ss18 n/a
5 TRCN0000119079 GAAGGCATGAACCAGCAATAT pLKO.1 1051 CDS 100% 13.200 10.560 N SS18 n/a
6 TRCN0000119080 CCTGGACCCAATCAACTCAAT pLKO.1 613 CDS 100% 4.950 3.960 N SS18 n/a
7 TRCN0000108561 CCTTATGAGGATTCCTCACAA pLKO.1 1138 CDS 100% 4.950 3.960 N Ss18 n/a
8 TRCN0000359419 GGGAATGATGGGTCAAGTTAA pLKO_005 897 CDS 100% 13.200 9.240 N SS18 n/a
9 TRCN0000119078 GTCAGCAGTATGGAGGATATA pLKO.1 1352 CDS 100% 13.200 9.240 N SS18 n/a
10 TRCN0000337695 TATTACCCTGATGGTCATAAT pLKO_005 1069 CDS 100% 13.200 9.240 N Ss18 n/a
11 TRCN0000359495 GATGCCTGGGCCTAACCATAT pLKO_005 579 CDS 100% 10.800 7.560 N SS18 n/a
12 TRCN0000359497 TGGTATACCTTGCTACAATAG pLKO_005 374 CDS 100% 10.800 7.560 N SS18 n/a
13 TRCN0000119077 CCTCCTTCTCAGCAATACAAT pLKO.1 829 CDS 100% 5.625 3.938 N SS18 n/a
14 TRCN0000108564 CCATGAATATGCCTTCAAGTA pLKO.1 647 CDS 100% 4.950 3.465 N Ss18 n/a
15 TRCN0000316422 CCATGAATATGCCTTCAAGTA pLKO_005 647 CDS 100% 4.950 3.465 N Ss18 n/a
16 TRCN0000119081 GCAGATGTTGCACACAAACTT pLKO.1 354 5UTR 100% 5.625 3.375 N SS18 n/a
17 TRCN0000304895 ATTACTACGAAGGAGGAAACT pLKO_005 1160 CDS 100% 4.950 3.465 N Ss18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526150.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07004 pDONR223 100% 87.4% 87.3% None 0_1ins156;83C>T n/a
2 ccsbBroad304_07004 pLX_304 0% 87.4% 87.3% V5 0_1ins156;83C>T n/a
3 TRCN0000467495 TCTGGGGAAACTTTGTTATGCGTC pLX_317 30.5% 87.4% 87.3% V5 0_1ins156;83C>T n/a
Download CSV