Transcript: Human XM_011526381.2

PREDICTED: Homo sapiens leukocyte immunoglobulin like receptor B3 (LILRB3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LILRB3 (11025)
Length:
2289
CDS:
112..2061

Additional Resources:

NCBI RefSeq record:
XM_011526381.2
NBCI Gene record:
LILRB3 (11025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526381.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056784 GTGGAGGTTCACATGCTATTA pLKO.1 684 CDS 100% 13.200 6.600 Y LILRB3 n/a
2 TRCN0000056783 TGACCAGAGAAAGACTGATTT pLKO.1 1587 CDS 100% 13.200 6.600 Y LILRB3 n/a
3 TRCN0000060502 GACACTTTCCTTCTGACCAAA pLKO.1 1165 CDS 100% 4.950 2.475 Y LILRA6 n/a
4 TRCN0000056787 GCTCATAAGTACCAGGCTGAA pLKO.1 1231 CDS 100% 4.050 2.025 Y LILRB3 n/a
5 TRCN0000056785 GTCACAGCAAACACAGGACAT pLKO.1 1565 CDS 100% 4.050 2.025 Y LILRB3 n/a
6 TRCN0000060501 GACAGAAATAACCCACTGGAA pLKO.1 319 CDS 100% 2.640 1.320 Y LILRA6 n/a
7 TRCN0000056786 CCTCCGATGTGGCTCACAGAA pLKO.1 534 CDS 100% 1.650 0.825 Y LILRB3 n/a
8 TRCN0000056847 CGACAGATTTGTTCTGTATAA pLKO.1 864 CDS 100% 1.320 0.660 Y LILRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526381.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11582 pDONR223 100% 95.9% 94.6% None (many diffs) n/a
2 ccsbBroad304_11582 pLX_304 0% 95.9% 94.6% V5 (many diffs) n/a
3 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 95.9% 94.6% V5 (many diffs) n/a
4 ccsbBroadEn_07723 pDONR223 100% 60.2% 51.9% None (many diffs) n/a
5 ccsbBroad304_07723 pLX_304 0% 60.2% 51.9% V5 (many diffs) n/a
6 TRCN0000478308 ATCGACTTCGATGCCTGGACTCCC pLX_317 25% 60.2% 51.9% V5 (many diffs) n/a
Download CSV