Transcript: Human XM_011526463.3

PREDICTED: Homo sapiens ZFP28 zinc finger protein (ZFP28), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFP28 (140612)
Length:
7208
CDS:
829..3408

Additional Resources:

NCBI RefSeq record:
XM_011526463.3
NBCI Gene record:
ZFP28 (140612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232346 AGTGACCACATAGGGCTTAAT pLKO_005 2344 CDS 100% 13.200 10.560 N ZFP28 n/a
2 TRCN0000017049 CCCTTATTTGTCATCGCAGAA pLKO.1 3029 CDS 100% 4.050 3.240 N ZFP28 n/a
3 TRCN0000232348 ACAACTGTGACAGACTATATG pLKO_005 4564 3UTR 100% 13.200 9.240 N ZFP28 n/a
4 TRCN0000232344 AGAGACTCACAAGCTATAATC pLKO_005 1409 CDS 100% 13.200 9.240 N ZFP28 n/a
5 TRCN0000232347 TGGACACCTTAATCAACATAA pLKO_005 3192 CDS 100% 13.200 9.240 N ZFP28 n/a
6 TRCN0000017048 CCAGTCATTTAAGGATTCATA pLKO.1 2615 CDS 100% 5.625 3.938 N ZFP28 n/a
7 TRCN0000017051 GCTGGGACTTTGTGTTTCTAA pLKO.1 1224 CDS 100% 5.625 3.938 N ZFP28 n/a
8 TRCN0000017052 CCTGTGGATCTGTTTCCCAAA pLKO.1 3352 CDS 100% 4.050 2.835 N ZFP28 n/a
9 TRCN0000232345 TCCGTCACTGGAGATACTATC pLKO_005 2276 CDS 100% 10.800 6.480 N ZFP28 n/a
10 TRCN0000017050 CCAGATTTAGTCTCTTTACTA pLKO.1 1621 CDS 100% 5.625 3.375 N ZFP28 n/a
11 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 2128 CDS 100% 15.000 7.500 Y Gm10771 n/a
12 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 2128 CDS 100% 15.000 7.500 Y ZNF286B n/a
13 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 2389 CDS 100% 4.950 2.475 Y ZNF28 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5190 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5190 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09590 pDONR223 100% 94% 92.4% None (many diffs) n/a
2 ccsbBroad304_09590 pLX_304 0% 94% 92.4% V5 (many diffs) n/a
3 TRCN0000474070 AGTCCACGCACTTCCCATCACCAT pLX_317 2.2% 94% 92.4% V5 (many diffs) n/a
4 ccsbBroadEn_16097 pDONR223 0% 32.8% 28.6% None (many diffs) n/a
5 ccsbBroad304_16097 pLX_304 0% 32.8% 28.6% V5 (many diffs) n/a
6 TRCN0000474632 TAGCGTTTCGTGTGATGTGCTTTC pLX_317 38.4% 32.8% 28.6% V5 (many diffs) n/a
Download CSV