Transcript: Human XM_011526503.2

PREDICTED: Homo sapiens zinc finger protein 420 (ZNF420), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF420 (147923)
Length:
3722
CDS:
392..2458

Additional Resources:

NCBI RefSeq record:
XM_011526503.2
NBCI Gene record:
ZNF420 (147923)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432248 GAACGTAGCATACCACAAATA pLKO_005 2888 3UTR 100% 13.200 18.480 N ZNF420 n/a
2 TRCN0000015849 CGTGATTCACAACTCAGTCTT pLKO.1 923 CDS 100% 4.950 6.930 N ZNF420 n/a
3 TRCN0000427524 AGGCAAGGGATGATCATATAT pLKO_005 713 CDS 100% 15.000 10.500 N ZNF420 n/a
4 TRCN0000427006 GAGAGTACTTATGAGTATAAT pLKO_005 2956 3UTR 100% 15.000 10.500 N ZNF420 n/a
5 TRCN0000433086 CCTTCAAGGTGTGCAAGTAAG pLKO_005 533 CDS 100% 10.800 7.560 N ZNF420 n/a
6 TRCN0000431498 ACACGACACCAGAGGATTCAT pLKO_005 1694 CDS 100% 5.625 3.938 N ZNF420 n/a
7 TRCN0000015852 CCTAACACAACATCAAAGTAT pLKO.1 850 CDS 100% 5.625 3.938 N ZNF420 n/a
8 TRCN0000015848 CGTGGCTTACTACTTATACAA pLKO.1 2015 CDS 100% 5.625 3.938 N ZNF420 n/a
9 TRCN0000015850 CTCAACATTCAAGATGTCATT pLKO.1 771 CDS 100% 4.950 3.465 N ZNF420 n/a
10 TRCN0000435637 TGATCTTGAAGAGTCCAATTC pLKO_005 628 CDS 100% 10.800 6.480 N ZNF420 n/a
11 TRCN0000015851 GCCTTTACTCAGAGTTCACAT pLKO.1 1922 CDS 100% 4.950 2.970 N ZNF420 n/a
12 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 1128 CDS 100% 5.625 2.813 Y ZNF829 n/a
13 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1307 CDS 100% 4.950 2.475 Y ZNF829 n/a
14 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1817 CDS 100% 4.050 2.025 Y ZNF700 n/a
15 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1308 CDS 100% 5.625 2.813 Y ZNF570 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05004 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05004 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479330 AGCGGACCGAGCAAAGCTACTGGT pLX_317 23.2% 100% 100% V5 n/a
Download CSV