Transcript: Human XM_011526529.3

PREDICTED: Homo sapiens proline and serine rich 3 (PROSER3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROSER3 (148137)
Length:
2884
CDS:
61..2466

Additional Resources:

NCBI RefSeq record:
XM_011526529.3
NBCI Gene record:
PROSER3 (148137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180523 GCCAGAGGATGACATTCTGTA pLKO.1 900 CDS 100% 4.950 3.465 N PROSER3 n/a
2 TRCN0000179989 CAAGATAGTCCCTTTGGAGAT pLKO.1 91 CDS 100% 4.050 2.430 N PROSER3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05007 pDONR223 100% 56.7% 55.7% None (many diffs) n/a
2 ccsbBroad304_05007 pLX_304 0% 56.7% 55.7% V5 (many diffs) n/a
3 TRCN0000475543 CCGCCGCTTGCTTCTCATTCCCTT pLX_317 15.7% 56.7% 55.7% V5 (many diffs) n/a
Download CSV