Transcript: Human XM_011526907.3

PREDICTED: Homo sapiens zinc finger protein 284 (ZNF284), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF284 (342909)
Length:
2397
CDS:
258..2039

Additional Resources:

NCBI RefSeq record:
XM_011526907.3
NBCI Gene record:
ZNF284 (342909)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239497 TTTATGGGTTACAGCATATTT pLKO_005 2052 3UTR 100% 15.000 21.000 N ZNF284 n/a
2 TRCN0000239498 AGAGAAGAAGAACTGTATAAA pLKO_005 1521 CDS 100% 15.000 10.500 N ZNF284 n/a
3 TRCN0000239500 GATGTGATACCTGTAGTAATA pLKO_005 1204 CDS 100% 13.200 9.240 N ZNF284 n/a
4 TRCN0000239499 TCTGAGCATGGGAAGTGTAAA pLKO_005 696 CDS 100% 13.200 9.240 N ZNF284 n/a
5 TRCN0000239496 CACTTGTAGGCAAGATCTTTG pLKO_005 1313 CDS 100% 10.800 7.560 N ZNF284 n/a
6 TRCN0000012966 CGGGAGAGAGACCTTATAATT pLKO.1 1606 CDS 100% 15.000 7.500 Y ZNF155 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07167 pDONR223 100% 76.7% 65.9% None (many diffs) n/a
2 ccsbBroad304_07167 pLX_304 0% 76.7% 65.9% V5 (many diffs) n/a
3 TRCN0000472100 CATTCGAGTACGACGCCCGCGCAT pLX_317 28.8% 76.7% 65.9% V5 (many diffs) n/a
4 ccsbBroadEn_01821 pDONR223 100% 73.7% 65.1% None (many diffs) n/a
5 ccsbBroad304_01821 pLX_304 0% 73.7% 65.1% V5 (many diffs) n/a
6 TRCN0000468268 AGACCACTGATCAAGATCTATTTA pLX_317 18.1% 73.7% 65.1% V5 (many diffs) n/a
Download CSV