Transcript: Human XM_011527041.3

PREDICTED: Homo sapiens POU class 2 homeobox 2 (POU2F2), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POU2F2 (5452)
Length:
7024
CDS:
80..1585

Additional Resources:

NCBI RefSeq record:
XM_011527041.3
NBCI Gene record:
POU2F2 (5452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527041.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245327 TCACTGCTACGACGCCAAATA pLKO_005 2226 3UTR 100% 13.200 18.480 N POU2F2 n/a
2 TRCN0000020820 GCACAACAGTTACTACCTTAT pLKO.1 1335 CDS 100% 10.800 15.120 N POU2F2 n/a
3 TRCN0000081521 CTTCGCCTTAGAGAAGAGTTT pLKO.1 1072 CDS 100% 4.950 6.930 N Pou2f2 n/a
4 TRCN0000081520 GAGCACAACAGTTACTACCTT pLKO.1 1333 CDS 100% 3.000 4.200 N Pou2f2 n/a
5 TRCN0000020823 GCTACCGACACCAAATCTATT pLKO.1 559 CDS 100% 13.200 9.240 N POU2F2 n/a
6 TRCN0000245324 GCTACCGACACCAAATCTATT pLKO_005 559 CDS 100% 13.200 9.240 N POU2F2 n/a
7 TRCN0000245326 CAGTCTGAGCACAACAGTTAC pLKO_005 1327 CDS 100% 10.800 7.560 N POU2F2 n/a
8 TRCN0000245323 GAAATGGACCAGACACTAATC pLKO_005 183 CDS 100% 10.800 7.560 N POU2F2 n/a
9 TRCN0000020821 GCACACAGACACCGAAAGAAA pLKO.1 166 CDS 100% 5.625 3.938 N POU2F2 n/a
10 TRCN0000425508 GAGCACACAGACACCGAAAGA pLKO_005 164 CDS 100% 4.950 3.465 N Pou2f2 n/a
11 TRCN0000020822 GCTCAACGATGCAGAGACTAT pLKO.1 937 CDS 100% 4.950 3.465 N POU2F2 n/a
12 TRCN0000245325 ACTTCAGCCAGACGACCATTT pLKO_005 849 CDS 100% 10.800 6.480 N POU2F2 n/a
13 TRCN0000020819 CCTCATCCTCTTCATCCTCAT pLKO.1 1774 3UTR 100% 4.050 2.430 N POU2F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527041.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11047 pDONR223 100% 79.8% 77% None (many diffs) n/a
2 ccsbBroad304_11047 pLX_304 42.1% 79.8% 77% V5 (many diffs) n/a
3 TRCN0000470280 ATCGGTGCCCCACATGACGGCCCA pLX_317 23.7% 79.8% 77% V5 (many diffs) n/a
Download CSV