Transcript: Human XM_011527087.2

PREDICTED: Homo sapiens kallikrein related peptidase 15 (KLK15), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLK15 (55554)
Length:
1859
CDS:
837..1352

Additional Resources:

NCBI RefSeq record:
XM_011527087.2
NBCI Gene record:
KLK15 (55554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372703 CTACGAGCGTGGACGCTTTAA pLKO_005 953 CDS 100% 13.200 18.480 N KLK15 n/a
2 TRCN0000372747 GCTCAAGGTCACCTGTTTAAT pLKO_005 1511 3UTR 100% 15.000 12.000 N KLK15 n/a
3 TRCN0000372712 CAAGTTGCTCTGTAGGAATTT pLKO_005 1555 3UTR 100% 13.200 9.240 N KLK15 n/a
4 TRCN0000052059 GATGGTGACAAGTTGCTGGAA pLKO.1 888 CDS 100% 2.640 1.848 N KLK15 n/a
5 TRCN0000052062 GACATCATGTTGCTGCGCCTA pLKO.1 1152 CDS 100% 2.160 1.512 N KLK15 n/a
6 TRCN0000052061 CTATACCAAAGTCTGCCACTA pLKO.1 1295 CDS 100% 4.050 2.430 N KLK15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03603 pDONR223 100% 66.7% 66.7% None 361_362ins255 n/a
2 ccsbBroad304_03603 pLX_304 0% 66.7% 66.7% V5 361_362ins255 n/a
3 TRCN0000471931 ACCCCTATGCAGCTGAGGTGGTTA pLX_317 57.2% 66.7% 66.7% V5 361_362ins255 n/a
4 ccsbBroadEn_08543 pDONR223 100% 66.6% 66.7% None 183C>A;361_362ins255 n/a
5 ccsbBroad304_08543 pLX_304 0% 66.6% 66.7% V5 183C>A;361_362ins255 n/a
6 TRCN0000478332 AACAGGACTAAGAACACTTAATGA pLX_317 53% 66.6% 66.7% V5 183C>A;361_362ins255 n/a
7 ccsbBroadEn_15901 pDONR223 0% 66.4% 66.4% None 41_43delCAG;361_362ins255 n/a
8 ccsbBroad304_15901 pLX_304 0% 66.4% 66.4% V5 41_43delCAG;361_362ins255 n/a
9 TRCN0000466623 CATCAAGGCAAAGACTTCACACAC pLX_317 37.1% 66.4% 66.4% V5 41_43delCAG;361_362ins255 n/a
Download CSV