Transcript: Human XM_011527264.3

PREDICTED: Homo sapiens myeloid zinc finger 1 (MZF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MZF1 (7593)
Length:
3628
CDS:
1183..3477

Additional Resources:

NCBI RefSeq record:
XM_011527264.3
NBCI Gene record:
MZF1 (7593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017135 CCGTTGCGATGTATGTGGCAA pLKO.1 2340 CDS 100% 2.640 3.696 N MZF1 n/a
2 TRCN0000017133 GTGTCCGCCATGGTCAGAACA pLKO.1 3496 3UTR 100% 1.650 2.310 N MZF1 n/a
3 TRCN0000329830 TTTCCGGTGCTTCCGCTATGA pLKO_005 1410 CDS 100% 4.950 3.960 N MZF1 n/a
4 TRCN0000017137 CCGCAGGTCCAGGTAGTGTAA pLKO.1 2072 CDS 100% 1.650 1.320 N MZF1 n/a
5 TRCN0000329903 CCGCAGGTCCAGGTAGTGTAA pLKO_005 2072 CDS 100% 1.650 1.320 N MZF1 n/a
6 TRCN0000329828 ACCAGAGCACCAAGCTCATTC pLKO_005 3428 CDS 100% 10.800 7.560 N MZF1 n/a
7 TRCN0000329827 GTTACAGAGGACTCAGATTTC pLKO_005 1837 CDS 100% 10.800 7.560 N MZF1 n/a
8 TRCN0000329905 ACCGTGCTGGACCAGATCTTT pLKO_005 1933 CDS 100% 5.625 3.938 N MZF1 n/a
9 TRCN0000017134 AGGTTACAGAGGACTCAGATT pLKO.1 1835 CDS 100% 4.950 3.465 N MZF1 n/a
10 TRCN0000017136 CCACCAGAGCACCAAGCTCAT pLKO.1 3426 CDS 100% 1.350 0.945 N MZF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01802 pDONR223 100% 96% 96% None 1_90del n/a
2 ccsbBroad304_01802 pLX_304 0% 96% 96% V5 1_90del n/a
3 TRCN0000478549 GTTCGAAACTAATAGTCGCCCTTT pLX_317 16.6% 96% 96% V5 1_90del n/a
4 ccsbBroadEn_15623 pDONR223 0% 37.9% 34.9% None (many diffs) n/a
5 ccsbBroad304_15623 pLX_304 0% 37.9% 34.9% V5 (many diffs) n/a
Download CSV