Transcript: Human XM_011527273.1

PREDICTED: Homo sapiens zinc finger protein 45 (ZNF45), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF45 (7596)
Length:
3811
CDS:
1005..3053

Additional Resources:

NCBI RefSeq record:
XM_011527273.1
NBCI Gene record:
ZNF45 (7596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017221 GCTCACACCTTAATATTCATT pLKO.1 2035 CDS 100% 5.625 7.875 N ZNF45 n/a
2 TRCN0000280435 GCTCACACCTTAATATTCATT pLKO_005 2035 CDS 100% 5.625 7.875 N ZNF45 n/a
3 TRCN0000017220 CGGAGCTCAGATCTTAATGTA pLKO.1 2451 CDS 100% 5.625 3.938 N ZNF45 n/a
4 TRCN0000297823 CGGAGCTCAGATCTTAATGTA pLKO_005 2451 CDS 100% 5.625 3.938 N ZNF45 n/a
5 TRCN0000017218 CGTGGACAAGTGTTTATCAAA pLKO.1 3566 3UTR 100% 5.625 3.938 N ZNF45 n/a
6 TRCN0000342912 CGTGGACAAGTGTTTATCAAA pLKO_005 3566 3UTR 100% 5.625 3.938 N ZNF45 n/a
7 TRCN0000017222 GCAACAGATTACAAGAGAGTT pLKO.1 1328 CDS 100% 4.950 3.465 N ZNF45 n/a
8 TRCN0000280434 GCAACAGATTACAAGAGAGTT pLKO_005 1328 CDS 100% 4.950 3.465 N ZNF45 n/a
9 TRCN0000017219 GCACTATAAAGATGAGGGATT pLKO.1 1418 CDS 100% 4.050 2.835 N ZNF45 n/a
10 TRCN0000235219 ACAGGAGAGAAACCCTATAAA pLKO_005 2487 CDS 100% 15.000 7.500 Y LOC66376 n/a
11 TRCN0000235327 ACAGGAGAGAAACCCTATAAA pLKO_005 2487 CDS 100% 15.000 7.500 Y OTTMUSG00000016228 n/a
12 TRCN0000243738 CAGGAGAGAAACCCTATAAAT pLKO_005 2488 CDS 100% 15.000 7.500 Y Gm14430 n/a
13 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 2404 CDS 100% 13.200 6.600 Y Zfp934 n/a
14 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 2404 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
15 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 2404 CDS 100% 13.200 6.600 Y EG668616 n/a
16 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 2402 CDS 100% 4.950 2.475 Y ZNF254 n/a
17 TRCN0000015356 GAGAAACCATACAAATGCAAT pLKO.1 1989 CDS 100% 4.950 2.475 Y ZNF285 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.