Transcript: Human XM_011527911.1

PREDICTED: Homo sapiens olfactory receptor family 10 subfamily H member 1 (OR10H1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR10H1 (26539)
Length:
1127
CDS:
47..1003

Additional Resources:

NCBI RefSeq record:
XM_011527911.1
NBCI Gene record:
OR10H1 (26539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357707 TGGCTTTGCCTCCGTCATTTA pLKO_005 805 CDS 100% 13.200 6.600 Y OR10H1 n/a
2 TRCN0000357775 ACACAAGGAGATCCACCATTT pLKO_005 556 CDS 100% 10.800 5.400 Y OR10H1 n/a
3 TRCN0000357708 TCTGCTGAAGGTCGGAACAAG pLKO_005 737 CDS 100% 4.950 2.475 Y OR10H1 n/a
4 TRCN0000357706 TGCGCTACAACGTGCTCATGA pLKO_005 435 CDS 100% 4.950 2.475 Y OR10H1 n/a
5 TRCN0000009277 GCCATCTTGAAGATCCCTTCT pLKO.1 719 CDS 100% 4.050 2.025 Y OR10H1 n/a
6 TRCN0000011786 GTTCCTGCTGATGTACCTGTT pLKO.1 136 CDS 100% 4.050 2.025 Y OR10H1 n/a
7 TRCN0000009284 CCAGTCAGATGTTCTTCTCCT pLKO.1 339 CDS 100% 2.640 1.320 Y OR10H2 n/a
8 TRCN0000009278 GATGTTCTTCTCCTTCAGCTT pLKO.1 346 CDS 100% 2.640 1.320 Y OR10H1 n/a
9 TRCN0000187492 GATGTTCTTCTCCTTCAGCTT pLKO.1 346 CDS 100% 2.640 1.320 Y OR10H5 n/a
10 TRCN0000009276 CGTCATTTACCTGAAGCCCAA pLKO.1 817 CDS 100% 2.160 1.080 Y OR10H1 n/a
11 TRCN0000189420 CGTCATTTACCTGAAGCCCAA pLKO.1 817 CDS 100% 2.160 1.080 Y OR10H5 n/a
12 TRCN0000009279 CCTCGCCTTCTGTGGACACAA pLKO.1 541 CDS 100% 1.650 0.825 Y OR10H1 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1078 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08027 pDONR223 100% 99.8% 100% None 393C>T n/a
2 ccsbBroad304_08027 pLX_304 0% 99.8% 100% V5 393C>T n/a
3 TRCN0000469520 ACGGAGTGAACTCCAGACTTATCC pLX_317 20.1% 99.8% 100% V5 393C>T n/a
4 ccsbBroadEn_08026 pDONR223 100% 88.5% 86.7% None (many diffs) n/a
5 ccsbBroad304_08026 pLX_304 0% 88.5% 86.7% V5 (many diffs) n/a
6 TRCN0000469165 CTCTACGTTAAGCCTTTGGCGTCT pLX_317 32.6% 88.5% 86.7% V5 (many diffs) n/a
Download CSV