Transcript: Human XM_011528227.3

PREDICTED: Homo sapiens transcription factor 3 (TCF3), transcript variant X34, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCF3 (6929)
Length:
4504
CDS:
287..2089

Additional Resources:

NCBI RefSeq record:
XM_011528227.3
NBCI Gene record:
TCF3 (6929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017534 CCCGGATCACTCAAGCAATAA pLKO.1 1156 CDS 100% 13.200 18.480 N TCF3 n/a
2 TRCN0000274218 CCCGGATCACTCAAGCAATAA pLKO_005 1156 CDS 100% 13.200 18.480 N TCF3 n/a
3 TRCN0000017536 GCCTGTTTGAAACGGCGAGAA pLKO.1 1970 CDS 100% 4.050 5.670 N TCF3 n/a
4 TRCN0000274219 GCCTGTTTGAAACGGCGAGAA pLKO_005 1970 CDS 100% 4.050 5.670 N TCF3 n/a
5 TRCN0000274217 ATTGTGCCTAAGCGAAATATT pLKO_005 2574 3UTR 100% 15.000 10.500 N TCF3 n/a
6 TRCN0000017533 CCTGGGAGTTTGATCTCTTAA pLKO.1 4130 3UTR 100% 13.200 9.240 N TCF3 n/a
7 TRCN0000274216 ACGGCCTGCAGAGTAAGATAG pLKO_005 1293 CDS 100% 10.800 7.560 N TCF3 n/a
8 TRCN0000086616 CCTGGACTTCAGCATGATGTT pLKO.1 343 CDS 100% 4.950 3.465 N Tcf3 n/a
9 TRCN0000017537 CCCGACTCCTACAGTGGGCTA pLKO.1 1568 CDS 100% 0.000 0.000 N TCF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14857 pDONR223 87.5% 91.3% 11.6% None (many diffs) n/a
2 ccsbBroad304_14857 pLX_304 0% 91.3% 11.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478054 CGCGCAATATACGCTCCCACCCCC pLX_317 9.3% 91.1% 11.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV