Transcript: Human XM_011528322.2

PREDICTED: Homo sapiens PBX homeobox 4 (PBX4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PBX4 (80714)
Length:
1359
CDS:
181..1047

Additional Resources:

NCBI RefSeq record:
XM_011528322.2
NBCI Gene record:
PBX4 (80714)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017964 CGTGGCATTCAAGACGAAGAT pLKO.1 127 5UTR 100% 4.950 6.930 N PBX4 n/a
2 TRCN0000431596 TGTATCGCCAGCCGTTGCTTT pLKO_005 1089 3UTR 100% 4.950 6.930 N PBX4 n/a
3 TRCN0000017963 GCTACCATTTACACGGGTAAA pLKO.1 757 CDS 100% 1.080 1.512 N PBX4 n/a
4 TRCN0000431299 ACACCAGGTGGCTGTCCAAAT pLKO_005 256 CDS 100% 10.800 7.560 N Pbx4 n/a
5 TRCN0000418830 AGCGTGCTCTGTGAGATCAAG pLKO_005 47 5UTR 100% 4.950 3.465 N PBX4 n/a
6 TRCN0000017966 GCAGCATCAACTCCAGTACAT pLKO.1 1019 CDS 100% 4.950 3.465 N PBX4 n/a
7 TRCN0000017965 TGTCCAAATGACAATAGCATT pLKO.1 268 CDS 100% 4.950 3.465 N PBX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04216 pDONR223 100% 77% 77% None 0_1ins258 n/a
2 ccsbBroad304_04216 pLX_304 0% 77% 77% V5 0_1ins258 n/a
3 TRCN0000475836 AATGCGTGCGCAGGACCCTAGGCA pLX_317 30.5% 77% 77% V5 0_1ins258 n/a
Download CSV