Transcript: Human XM_011528374.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor E3 (ADGRE3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRE3 (84658)
Length:
2192
CDS:
91..1998

Additional Resources:

NCBI RefSeq record:
XM_011528374.2
NBCI Gene record:
ADGRE3 (84658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356971 TGGAGACATGTAACGACATTA pLKO_005 224 CDS 100% 13.200 18.480 N ADGRE3 n/a
2 TRCN0000356972 ATTCAACTTGAACGTCCAAAT pLKO_005 666 CDS 100% 10.800 15.120 N ADGRE3 n/a
3 TRCN0000356970 GTGGTTTAGAGAGATCGTAAA pLKO_005 1872 CDS 100% 10.800 15.120 N ADGRE3 n/a
4 TRCN0000008246 CGTGAACAAGAGTCACACCAT pLKO.1 1014 CDS 100% 2.640 3.696 N ADGRE3 n/a
5 TRCN0000356973 CACCTGCAACCATGGATATAC pLKO_005 168 CDS 100% 13.200 9.240 N ADGRE3 n/a
6 TRCN0000008243 CATGGATCTCTTTGGCATTAT pLKO.1 2035 3UTR 100% 13.200 9.240 N ADGRE3 n/a
7 TRCN0000008247 CTGGGCAGAAACTATTCACAT pLKO.1 197 CDS 100% 4.950 3.465 N ADGRE3 n/a
8 TRCN0000008244 CCAGGGATTCATGTGGAGTTT pLKO.1 1542 CDS 100% 4.950 2.970 N ADGRE3 n/a
9 TRCN0000008245 CCAAATGAACTCAATGGACAT pLKO.1 681 CDS 100% 4.050 2.430 N ADGRE3 n/a
10 TRCN0000221170 GCTGACTGTCATCACCTACAT pLKO.1 1104 CDS 100% 4.950 2.475 Y ADGRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488159 AAAGAGACGACCAAAAGTACATGC pLX_317 18.3% 97.3% 97% V5 (not translated due to prior stop codon) 25_26ins51;1103G>A n/a
2 TRCN0000491459 AAAGGTGTCCGTACCCTGTTCCGA pLX_317 19% 97.2% 96.9% V5 25_26ins51;1103G>A;1905_1906insG n/a
Download CSV