Construct: ORF TRCN0000489391
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020790.1_s317c1
- DNA Barcode:
- CGGCTAAAATAAGGTTTGTATGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- OPRL1 (4987)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489391
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_000913.6 | 99.9% | 99.7% | 44G>A |
| 2 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001200019.2 | 99.9% | 99.7% | 44G>A |
| 3 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_182647.4 | 99.9% | 99.7% | 44G>A |
| 4 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027854.1 | 99.9% | 99.7% | 44G>A |
| 5 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318854.1 | 98.5% | 98.3% | 44G>A;218_219insGTACGTCATCCTCAG |
| 6 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027855.1 | 98.5% | 98.3% | 44G>A;218_219insGTACGTCATCCTCAG |
| 7 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_011528828.3 | 95.2% | 95.1% | 1_54del;98G>A |
| 8 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027853.1 | 95.2% | 95.1% | 1_54del;98G>A |
| 9 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318853.2 | 92.6% | 99.7% | 44G>A;1111_1197del |
| 10 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318855.1 | 87.4% | 80.6% | 0_1ins115;118_145del |
| 11 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_011528830.3 | 78.1% | 78.1% | 0_1ins243 |
| 12 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001252565.1 | 85.2% | 93.5% | (many diffs) |
| 13 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_011012.5 | 85.2% | 93.5% | (many diffs) |
| 14 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316323.1 | 85.2% | 93.5% | (many diffs) |
| 15 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316325.1 | 85.2% | 93.5% | (many diffs) |
| 16 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318920.1 | 84% | 92.1% | (many diffs) |
| 17 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_006500582.2 | 84% | 92.1% | (many diffs) |
| 18 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318919.1 | 79.1% | 93.5% | (many diffs) |
| 19 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318923.1 | 78.5% | 77.3% | (many diffs) |
| 20 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318922.1 | 77.9% | 76.3% | (many diffs) |
| 21 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318924.1 | 67.9% | 75.4% | (many diffs) |
| 22 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318925.1 | 67.9% | 75.4% | (many diffs) |
| 23 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_006500584.2 | 67.9% | 75.4% | (many diffs) |
| 24 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316326.1 | 67.9% | 75.4% | (many diffs) |
| 25 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316328.1 | 67.9% | 75.4% | (many diffs) |
| 26 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316329.1 | 67.9% | 75.4% | (many diffs) |
| 27 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316330.1 | 67.9% | 75.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1182
- ORF length:
- 1110
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagccc ctcttccccg cgccgttctg ggaggttatc tacgacagcc 121 accttcaggg caacctgtcc ctcctgagcc ccaaccacag tctgctgccc ccgcatctgc 181 tgctcaatgc cagccacggc gccttcctgc ccctcgggct caaggtcacc atcgtggggc 241 tctacctggc cgtgtgtgtc ggagggctcc tggggaactg ccttgtcatg tacgtcatcc 301 tcaggcacac caaaatgaag acagccacca atatttacat ctttaacctg gccctggccg 361 acactctggt cctgctgacg ctgcccttcc agggcacgga catcctcctg ggcttctggc 421 cgtttgggaa tgcgctgtgc aagacagtca ttgccattga ctactacaac atgttcacca 481 gcaccttcac cctaactgcc atgagtgtgg atcgctatgt agccatctgc caccccatcc 541 gtgccctcga cgtccgcacg tccagcaaag cccaggctgt caatgtggcc atctgggccc 601 tggcctctgt tgtcggtgtt cccgttgcca tcatgggctc ggcacaggtc gaggatgaag 661 agatcgagtg cctggtggag atccctaccc ctcaggatta ctggggcccg gtgtttgcca 721 tctgcatctt cctcttctcc ttcatcgtcc ccgtgctcgt catctctgtc tgctacagcc 781 tcatgatccg gcggctccgt ggagtccgcc tgctctcggg ctcccgagag aaggaccgga 841 acctGCGGCG CATCACTCGG CTGGTGCTGG TGGTAGTGGC TGTGTTCGTG GGCTGCTGGA 901 CGCCTGTCCA GGTCTTCGTG CTGGCCCAAG GGCTGGGGGT TCAGCCGAGC AGCGAGACTG 961 CCGTGGCCAT TCTGCGCTTC TGCACGGCCC TGGGCTACGT CAACAGCTGC CTCAACCCCA 1021 TCCTCTACGC CTTCCTGGAT GAGAACTTCA AGGCCTGCTT CCGCAAGTTC TGCTGTGCAT 1081 CTGCCCTGCG CCGGGACGTG CAGGTGTCTG ACCGCGTGCG CAGCATTGCC AAGGACGTGG 1141 CCCTGGCCTG CAAGACCTCT GAGACGGTAC CGCGGCCCGC ATAGGACCCA GCTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA CGGCTAAAAT AAGGTTTGTA TGAAACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt