Transcript: Human XM_011529003.1

PREDICTED: Homo sapiens lipin 3 (LPIN3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPIN3 (64900)
Length:
2783
CDS:
157..2430

Additional Resources:

NCBI RefSeq record:
XM_011529003.1
NBCI Gene record:
LPIN3 (64900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161215 GTGGTAGACATTGAGCTCAAT pLKO.1 346 CDS 100% 4.950 6.930 N LPIN3 n/a
2 TRCN0000163735 GACCCAAACCTAGTGGTGAAA pLKO.1 1585 CDS 100% 4.950 3.960 N LPIN3 n/a
3 TRCN0000164527 CTGCAAGAAGGTGCCAATGAT pLKO.1 1975 CDS 100% 5.625 3.938 N LPIN3 n/a
4 TRCN0000162391 CTGGACACAGTGGATACAATA pLKO.1 1453 CDS 100% 13.200 7.920 N LPIN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12504 pDONR223 100% 79.3% 81.7% None 2043_2178del;2271_2272ins421 n/a
2 ccsbBroad304_12504 pLX_304 0% 79.3% 81.7% V5 2043_2178del;2271_2272ins421 n/a
3 TRCN0000479685 TCGTGGTTTTAGTCAGATAAGTGT pLX_317 11.1% 79.3% 81.7% V5 2043_2178del;2271_2272ins421 n/a
Download CSV