Transcript: Human XM_011529543.2

PREDICTED: Homo sapiens high mobility group nucleosome binding domain 1 (HMGN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HMGN1 (3150)
Length:
2020
CDS:
1030..1536

Additional Resources:

NCBI RefSeq record:
XM_011529543.2
NBCI Gene record:
HMGN1 (3150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380827 TCGGGTGTCAGCTTAACATTC pLKO_005 1483 CDS 100% 10.800 8.640 N HMGN1 n/a
2 TRCN0000330142 GTACAATCCAGAGGAATATTT pLKO_005 1268 CDS 100% 15.000 10.500 N HMGN1 n/a
3 TRCN0000380992 ATGGAGTCAGTCCTGCATTTA pLKO_005 1560 3UTR 100% 13.200 9.240 N HMGN1 n/a
4 TRCN0000330070 GTCTGATTAATAACCATATAC pLKO_005 1214 CDS 100% 13.200 9.240 N HMGN1 n/a
5 TRCN0000019059 CCAAGAAACTAAAGAAGACTT pLKO.1 1121 CDS 100% 4.950 3.465 N HMGN1 n/a
6 TRCN0000019062 GCTAACCAAGAAACTAAAGAA pLKO.1 1116 CDS 100% 5.625 3.375 N HMGN1 n/a
7 TRCN0000330069 GCTAACCAAGAAACTAAAGAA pLKO_005 1116 CDS 100% 5.625 3.375 N HMGN1 n/a
8 TRCN0000019063 CTCTGATGAAGCAGGAGAGAA pLKO.1 1184 CDS 100% 4.950 2.970 N HMGN1 n/a
9 TRCN0000019061 GTCAGCTAAACCTCCTGCAAA pLKO.1 243 5UTR 100% 4.950 2.475 Y HMGN1 n/a
10 TRCN0000330139 GTCAGCTAAACCTCCTGCAAA pLKO_005 243 5UTR 100% 4.950 2.475 Y HMGN1 n/a
11 TRCN0000093076 CGATGCCCAAGAGGAAGGTTA pLKO.1 170 5UTR 100% 4.950 3.465 N LOC433602 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00753 pDONR223 100% 28.2% 4.4% None 0_1ins123;2_15del;192_504del n/a
2 ccsbBroad304_00753 pLX_304 0% 28.2% 4.4% V5 0_1ins123;2_15del;192_504del n/a
3 TRCN0000471003 CTCACCACCTATTTCTTGGTGTCC pLX_317 100% 28.2% 4.4% V5 0_1ins123;2_15del;192_504del n/a
4 TRCN0000488921 AAGTCAGACCCAGGGTTGAACCGA pLX_317 100% 28.2% 4.4% V5 (not translated due to prior stop codon) 0_1ins123;2_15del;192_504del n/a
Download CSV