Transcript: Human XM_011529825.1

PREDICTED: Homo sapiens growth arrest specific 2 like 1 (GAS2L1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAS2L1 (10634)
Length:
2475
CDS:
140..2185

Additional Resources:

NCBI RefSeq record:
XM_011529825.1
NBCI Gene record:
GAS2L1 (10634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184129 CTCTTGAGTACCAGACCTCAT pLKO.1 2272 3UTR 100% 4.050 5.670 N GAS2L1 n/a
2 TRCN0000154892 CTGACCAGTTTCCCATGATCA pLKO.1 804 CDS 100% 4.950 3.960 N GAS2L1 n/a
3 TRCN0000247528 GACCAGTTTCCCATGATCAAG pLKO_005 806 CDS 100% 4.950 3.465 N Gas2l1 n/a
4 TRCN0000155338 GAGATGACTCCCGTTAGCTTA pLKO.1 1094 CDS 100% 4.950 3.465 N GAS2L1 n/a
5 TRCN0000155759 CCGTTAGCTTACGAAGCACAA pLKO.1 1104 CDS 100% 4.050 2.835 N GAS2L1 n/a
6 TRCN0000430037 ATTACCTGGACAAGCACGACC pLKO_005 936 CDS 100% 2.160 1.512 N GAS2L1 n/a
7 TRCN0000436578 ATTTCGCTCCAGTGAGGCCTA pLKO_005 193 CDS 100% 2.160 1.512 N GAS2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07659 pDONR223 100% 99.9% 99.8% None 1631C>T n/a
2 ccsbBroad304_07659 pLX_304 0% 99.9% 99.8% V5 1631C>T n/a
3 ccsbBroadEn_07658 pDONR223 100% 99.9% 99.8% None 30C>T;1205G>N n/a
4 ccsbBroad304_07658 pLX_304 0% 99.9% 99.8% V5 30C>T;1205G>N n/a
5 TRCN0000480521 AAGGACGGTTGATCGAGCTACATC pLX_317 19.9% 99.9% 99.8% V5 30C>T;1205G>N n/a
Download CSV