Transcript: Human XM_011529874.2

PREDICTED: Homo sapiens EMI domain containing 1 (EMID1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EMID1 (129080)
Length:
4759
CDS:
2913..4106

Additional Resources:

NCBI RefSeq record:
XM_011529874.2
NBCI Gene record:
EMID1 (129080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117087 CGCCCGTCCATATTTATTAAT pLKO.1 4183 3UTR 100% 15.000 21.000 N EMID1 n/a
2 TRCN0000117091 CCGCACCATCTCATGCCATGT pLKO.1 2843 5UTR 100% 1.350 1.080 N EMID1 n/a
3 TRCN0000288919 CCGCACCATCTCATGCCATGT pLKO_005 2843 5UTR 100% 1.350 1.080 N EMID1 n/a
4 TRCN0000296033 TGACCATGCTGACTGTCATAG pLKO_005 3184 CDS 100% 10.800 7.560 N EMID1 n/a
5 TRCN0000117089 ACCCACATACAAGGTGATGTA pLKO.1 2951 CDS 100% 4.950 3.465 N EMID1 n/a
6 TRCN0000288918 ACCCACATACAAGGTGATGTA pLKO_005 2951 CDS 100% 4.950 3.465 N EMID1 n/a
7 TRCN0000296034 CAAGGAGGGATAGAGGTACAA pLKO_005 4350 3UTR 100% 4.950 3.465 N EMID1 n/a
8 TRCN0000117090 ACATGCAACCAACTACCGGAT pLKO.1 4052 CDS 100% 2.160 1.512 N EMID1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09520 pDONR223 100% 78.5% 77.5% None (many diffs) n/a
2 ccsbBroad304_09520 pLX_304 0% 78.5% 77.5% V5 (many diffs) n/a
3 TRCN0000472939 TGCCGCAGGGCTCACCCAATTTGA pLX_317 14.9% 78.5% 77.5% V5 (many diffs) n/a
Download CSV