Transcript: Human XM_011529963.2

PREDICTED: Homo sapiens cysteine rich DPF motif domain containing 1 (CDPF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDPF1 (150383)
Length:
871
CDS:
526..867

Additional Resources:

NCBI RefSeq record:
XM_011529963.2
NBCI Gene record:
CDPF1 (150383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133698 GAAAGCTATGTCATGAAGGAT pLKO.1 647 CDS 100% 3.000 2.100 N CDPF1 n/a
2 TRCN0000135520 GAGTGTTTGAGTGTGAACTCT pLKO.1 557 CDS 100% 3.000 2.100 N CDPF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05042 pDONR223 100% 70.2% 38.4% None (many diffs) n/a
2 ccsbBroad304_05042 pLX_304 0% 70.2% 38.4% V5 (many diffs) n/a
3 TRCN0000471253 AACCCTATTTCCATTGACTATCTC pLX_317 100% 70.2% 38.4% V5 (many diffs) n/a
Download CSV