Transcript: Human XM_011530120.3

PREDICTED: Homo sapiens sulfotransferase family 4A member 1 (SULT4A1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SULT4A1 (25830)
Length:
1500
CDS:
53..568

Additional Resources:

NCBI RefSeq record:
XM_011530120.3
NBCI Gene record:
SULT4A1 (25830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034959 CCGGAGGTTTATGAATGATAA pLKO.1 538 CDS 100% 13.200 18.480 N SULT4A1 n/a
2 TRCN0000034962 CGATGAGATCGGCTTGATGAA pLKO.1 274 CDS 100% 4.950 3.960 N SULT4A1 n/a
3 TRCN0000034960 CCGAGGCACCTTTCAAGAATT pLKO.1 514 CDS 100% 0.000 0.000 N SULT4A1 n/a
4 TRCN0000034963 CAATGGAGACTCCAAGGTCAT pLKO.1 418 CDS 100% 4.050 2.835 N SULT4A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530120.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11771 pDONR223 100% 65.4% 65.3% None 509delA;513_513delAins269 n/a
2 ccsbBroad304_11771 pLX_304 0% 65.4% 65.3% V5 509delA;513_513delAins269 n/a
3 TRCN0000473443 TTTCTGCTCTAGGACCTTCAATGA pLX_317 43.2% 65.4% 65.3% V5 509delA;513_513delAins269 n/a
4 ccsbBroadEn_07948 pDONR223 100% 59.7% 59.8% None 378C>A;509delA;513_513delAins341 n/a
5 ccsbBroad304_07948 pLX_304 0% 59.7% 59.8% V5 378C>A;509delA;513_513delAins341 n/a
6 ccsbBroadEn_15772 pDONR223 0% 59.4% 59.1% None 163_166delAAGTinsC;509delA;513_513delAins341 n/a
7 ccsbBroad304_15772 pLX_304 0% 59.4% 59.1% V5 163_166delAAGTinsC;509delA;513_513delAins341 n/a
8 TRCN0000470668 CCACGCCACATGCTCTAAGAGTAT pLX_317 19.6% 59.4% 59.1% V5 163_166delAAGTinsC;509delA;513_513delAins341 n/a
Download CSV