Transcript: Human XM_011530121.1

PREDICTED: Homo sapiens sulfotransferase family 4A member 1 (SULT4A1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SULT4A1 (25830)
Length:
2068
CDS:
61..576

Additional Resources:

NCBI RefSeq record:
XM_011530121.1
NBCI Gene record:
SULT4A1 (25830)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444163 GCATGGACTCGAACGTGCTTT pLKO_005 278 CDS 100% 4.950 6.930 N SULT4A1 n/a
2 TRCN0000454990 ACAACCTGCATGCTCACAATA pLKO_005 588 3UTR 100% 13.200 9.240 N SULT4A1 n/a
3 TRCN0000034961 CTTGGTGTATAAACAGAAGAT pLKO.1 519 CDS 100% 4.950 3.465 N SULT4A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15772 pDONR223 0% 60.1% 60% None (many diffs) n/a
2 ccsbBroad304_15772 pLX_304 0% 60.1% 60% V5 (many diffs) n/a
3 TRCN0000470668 CCACGCCACATGCTCTAAGAGTAT pLX_317 19.6% 60.1% 60% V5 (many diffs) n/a
4 ccsbBroadEn_07948 pDONR223 100% 60% 59.5% None 169_170ins339;377A>G n/a
5 ccsbBroad304_07948 pLX_304 0% 60% 59.5% V5 169_170ins339;377A>G n/a
6 ccsbBroadEn_11771 pDONR223 100% 50.2% 47.5% None (many diffs) n/a
7 ccsbBroad304_11771 pLX_304 0% 50.2% 47.5% V5 (many diffs) n/a
8 TRCN0000473443 TTTCTGCTCTAGGACCTTCAATGA pLX_317 43.2% 50.2% 47.5% V5 (many diffs) n/a
Download CSV