Transcript: Human XM_011530769.2

PREDICTED: Homo sapiens X antigen family member 3 (XAGE3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XAGE3 (170626)
Length:
546
CDS:
121..456

Additional Resources:

NCBI RefSeq record:
XM_011530769.2
NBCI Gene record:
XAGE3 (170626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115714 GTGAATGTGGAAATGGTCCTG pLKO.1 359 CDS 100% 2.160 1.512 N XAGE3 n/a
2 TRCN0000115716 CCTAGGCCGAGGAGAAGTGTA pLKO.1 151 CDS 100% 1.650 1.155 N XAGE3 n/a
3 TRCN0000115712 CCGAGGAGAAGTGTACCACCT pLKO.1 157 CDS 100% 0.720 0.504 N XAGE3 n/a
4 TRCN0000115715 GCCCGGTGATGAGGAGCCTCA pLKO.1 204 CDS 100% 0.000 0.000 N XAGE3 n/a
5 TRCN0000443669 AGAAGATCAGGGTGCAGCTGA pLKO_005 279 CDS 100% 2.640 1.584 N XAGE3 n/a
6 TRCN0000115713 CCTATGCTGGAGCCCGGTGAT pLKO.1 193 CDS 100% 0.000 0.000 N XAGE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05158 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05158 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467575 TTGCTGCAGTTATCGCAACGATGA pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_07432 pDONR223 100% 86.4% 72% None (many diffs) n/a
5 ccsbBroad304_07432 pLX_304 0% 86.4% 72% V5 (many diffs) n/a
6 TRCN0000466509 CAATCCCTTATATCTCACTTAATC pLX_317 100% 86.4% 72% V5 (many diffs) n/a
7 ccsbBroadEn_02177 pDONR223 100% 86.4% 72% None (many diffs) n/a
8 ccsbBroad304_02177 pLX_304 0% 86.4% 72% V5 (many diffs) n/a
9 TRCN0000479423 TCGAACCTCGATATGGATCACTAC pLX_317 50.7% 86.4% 72% V5 (many diffs) n/a
Download CSV