Transcript: Human XM_011530905.2

PREDICTED: Homo sapiens interleukin 1 receptor accessory protein like 2 (IL1RAPL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL1RAPL2 (26280)
Length:
3893
CDS:
137..1825

Additional Resources:

NCBI RefSeq record:
XM_011530905.2
NBCI Gene record:
IL1RAPL2 (26280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427804 CAACAGCAGGATCCGCTATTT pLKO_005 190 CDS 100% 13.200 18.480 N IL1RAPL2 n/a
2 TRCN0000429547 CACTAAAGCGTAGCATCAAAC pLKO_005 1332 CDS 100% 10.800 15.120 N IL1RAPL2 n/a
3 TRCN0000058486 GCGAATTATACCTGCCATGTT pLKO.1 743 CDS 100% 4.950 6.930 N IL1RAPL2 n/a
4 TRCN0000434234 GCACTGTTGCAGAGGTTATAA pLKO_005 1609 CDS 100% 15.000 10.500 N IL1RAPL2 n/a
5 TRCN0000426140 GTGCTAACTCCAGACTATATT pLKO_005 1181 CDS 100% 15.000 10.500 N IL1RAPL2 n/a
6 TRCN0000058485 GCCTGATGTTGTGTGGTATAA pLKO.1 286 CDS 100% 13.200 9.240 N IL1RAPL2 n/a
7 TRCN0000058487 CCTCCAAAGAGCTTAGCTTTA pLKO.1 1788 CDS 100% 10.800 7.560 N IL1RAPL2 n/a
8 TRCN0000066609 CCAATGATCTACTGGATGAAA pLKO.1 593 CDS 100% 5.625 3.938 N Il1rapl2 n/a
9 TRCN0000058484 CCCTGAAAGATACCCAGGAAT pLKO.1 1737 CDS 100% 4.950 3.465 N IL1RAPL2 n/a
10 TRCN0000058483 GCACTCATCTTTGACTCAGTT pLKO.1 707 CDS 100% 4.950 3.465 N IL1RAPL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02951 pDONR223 100% 81.9% 81.9% None 0_1ins372 n/a
2 ccsbBroad304_02951 pLX_304 0% 81.9% 81.9% V5 0_1ins372 n/a
3 TRCN0000476821 GCACAATATTAATATTCAAATAAT pLX_317 18% 81.9% 81.9% V5 0_1ins372 n/a
Download CSV