Transcript: Human XM_011531160.3

PREDICTED: Homo sapiens MAGE family member A3 (MAGEA3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAGEA3 (4102)
Length:
1739
CDS:
225..1169

Additional Resources:

NCBI RefSeq record:
XM_011531160.3
NBCI Gene record:
MAGEA3 (4102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531160.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128406 GCAGTATTTCTTTCCTGTGAT pLKO.1 653 CDS 100% 4.950 2.970 N MAGEA3 n/a
2 TRCN0000129751 CGGAAATTGGCAGTATTTCTT pLKO.1 644 CDS 100% 0.563 0.338 N MAGEA3 n/a
3 TRCN0000435819 GATAATCGTCCTGGCCATAAT pLKO_005 830 CDS 100% 13.200 6.600 Y MAGEA2 n/a
4 TRCN0000282137 GCCGGTCACAAAGGCAGAAAT pLKO_005 608 CDS 100% 13.200 6.600 Y MAGEA9B n/a
5 TRCN0000153016 GCCCATTCTTCACTCTTTGAA pLKO.1 1271 3UTR 100% 5.625 2.813 Y MAGEA6 n/a
6 TRCN0000129750 CCAGGTTTATGAATGACAGTA pLKO.1 1416 3UTR 100% 4.950 2.475 Y MAGEA3 n/a
7 TRCN0000143087 CGTTGAAACCAGCTATGTGAA pLKO.1 1058 CDS 100% 4.950 2.475 Y MAGEA12 n/a
8 TRCN0000128375 GAATGACAGTAGTCACACATA pLKO.1 1426 3UTR 100% 4.950 2.475 Y MAGEA3 n/a
9 TRCN0000154704 GCTGGGTGACAATCAGATCAT pLKO.1 791 CDS 100% 4.950 2.475 Y MAGEA6 n/a
10 TRCN0000127630 CTGATAATCGTCCTGGCCATA pLKO.1 828 CDS 100% 4.050 2.025 Y MAGEA3 n/a
11 TRCN0000155661 CCTGTGATCTTCAGCAAAGCT pLKO.1 666 CDS 100% 3.000 1.500 Y MAGEA6 n/a
12 TRCN0000151826 CTTCTACTCTAGTTGAAGTCA pLKO.1 349 CDS 100% 3.000 1.500 Y MAGEA6 n/a
13 TRCN0000142910 CTTTCCTGTGATCTTCAGCAA pLKO.1 662 CDS 100% 2.640 1.320 Y MAGEA12 n/a
14 TRCN0000141457 CAGCTATGTGAAAGTCCTGCA pLKO.1 1067 CDS 100% 2.160 1.080 Y MAGEA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531160.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00967 pDONR223 100% 34.3% 28.3% None (many diffs) n/a
2 ccsbBroad304_00967 pLX_304 0% 34.3% 28.3% V5 (many diffs) n/a
3 TRCN0000474004 TTCCCTTAAAATCATCCATACATA pLX_317 58.4% 34.3% 28.3% V5 (many diffs) n/a
Download CSV