Transcript: Human XM_011531301.2

PREDICTED: Homo sapiens family with sequence similarity 122C (FAM122C), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM122C (159091)
Length:
966
CDS:
35..592

Additional Resources:

NCBI RefSeq record:
XM_011531301.2
NBCI Gene record:
FAM122C (159091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263941 AGGAAGAAGCCATGGATTTAA pLKO_005 24 5UTR 100% 15.000 21.000 N FAM122C n/a
2 TRCN0000263939 CTCTCTAAAGTGCATTGATTT pLKO_005 151 CDS 100% 13.200 10.560 N FAM122C n/a
3 TRCN0000263940 TGCTGGATCTTCTGGTAATTC pLKO_005 502 CDS 100% 13.200 9.240 N FAM122C n/a
4 TRCN0000167421 GCAATGAGAATTGTACTGTAT pLKO.1 679 3UTR 100% 4.950 3.465 N FAM122C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05101 pDONR223 100% 37.5% 12.6% None 0_1ins255;90_333del;555_556insTAGTAGACAAACTTTCAAC n/a
2 ccsbBroad304_05101 pLX_304 0% 37.5% 12.6% V5 0_1ins255;90_333del;555_556insTAGTAGACAAACTTTCAAC n/a
3 TRCN0000471934 AGGTCATATACCATCAGAGCGAAC pLX_317 64.9% 37.5% 12.6% V5 0_1ins255;90_333del;555_556insTAGTAGACAAACTTTCAAC n/a
4 ccsbBroadEn_05102 pDONR223 100% 24.1% 22.9% None (many diffs) n/a
5 TRCN0000478791 GTTGATACAACTCGAAATACACCT pLX_317 83.4% 24.1% 22.9% V5 (many diffs) n/a
Download CSV