Transcript: Human XM_011531349.1

PREDICTED: Homo sapiens serine/threonine kinase 26 (STK26), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK26 (51765)
Length:
3309
CDS:
569..1525

Additional Resources:

NCBI RefSeq record:
XM_011531349.1
NBCI Gene record:
STK26 (51765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195233 CAACTCATGTTATGGGTTAAA pLKO.1 3099 3UTR 100% 13.200 18.480 N STK26 n/a
2 TRCN0000003193 CCAGATTGCTACCATGCTAAA pLKO.1 631 CDS 100% 10.800 15.120 N STK26 n/a
3 TRCN0000320666 CCAGATTGCTACCATGCTAAA pLKO_005 631 CDS 100% 10.800 15.120 N STK26 n/a
4 TRCN0000003192 CATCATTTCGTCCTACAGCAA pLKO.1 1050 CDS 100% 2.640 2.112 N STK26 n/a
5 TRCN0000003191 CCTCTTGGTGTATAGTATTTA pLKO.1 2155 3UTR 100% 15.000 10.500 N STK26 n/a
6 TRCN0000320745 CCTCTTGGTGTATAGTATTTA pLKO_005 2155 3UTR 100% 15.000 10.500 N STK26 n/a
7 TRCN0000350279 TCATTGGGAATTACTGCTATT pLKO_005 884 CDS 100% 10.800 7.560 N STK26 n/a
8 TRCN0000003194 GATCCAAAGAAAGTACAGAAT pLKO.1 1274 CDS 100% 4.950 3.465 N STK26 n/a
9 TRCN0000320742 GATCCAAAGAAAGTACAGAAT pLKO_005 1274 CDS 100% 4.950 3.465 N STK26 n/a
10 TRCN0000196861 GCTCCTGAAGTTATTCAACAG pLKO.1 833 CDS 100% 4.050 2.835 N STK26 n/a
11 TRCN0000003195 CTTAAACAGCAGGACGAGAAT pLKO.1 1364 CDS 100% 4.950 2.970 N STK26 n/a
12 TRCN0000320668 CTTAAACAGCAGGACGAGAAT pLKO_005 1364 CDS 100% 4.950 2.970 N STK26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489362 TAACTTCACCGACTGAACCTGCCG pLX_317 23.4% 76.4% 76.4% V5 (not translated due to prior stop codon) 0_1ins294 n/a
2 TRCN0000488583 CCTCGCAATGTAAACGGTGATGAG pLX_317 22.6% 76.3% 76.2% V5 0_1ins294;954_955insG n/a
3 TRCN0000488375 TTCTCACGTAATATCCGCCAGCGC pLX_317 28.3% 61.5% 61.5% V5 (not translated due to prior stop codon) 0_1ins294;304_489del n/a
Download CSV