Transcript: Human XM_011531412.3

PREDICTED: Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor 6 (ARHGEF6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF6 (9459)
Length:
4923
CDS:
33..2444

Additional Resources:

NCBI RefSeq record:
XM_011531412.3
NBCI Gene record:
ARHGEF6 (9459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007404 CGTCATCATGTAGTGCTCATT pLKO.1 1795 CDS 100% 4.950 3.960 N ARHGEF6 n/a
2 TRCN0000279991 CGTCATCATGTAGTGCTCATT pLKO_005 1795 CDS 100% 4.950 3.960 N ARHGEF6 n/a
3 TRCN0000007402 CCAGTAATTATGTCCGTGAAA pLKO.1 661 CDS 100% 4.950 3.465 N ARHGEF6 n/a
4 TRCN0000007401 CCGTGGAGTTTAAGTTGTCTA pLKO.1 1875 CDS 100% 4.950 3.465 N ARHGEF6 n/a
5 TRCN0000280057 CCGTGGAGTTTAAGTTGTCTA pLKO_005 1875 CDS 100% 4.950 3.465 N ARHGEF6 n/a
6 TRCN0000007400 GCTGAATGATTTGACTCAGTT pLKO.1 2498 3UTR 100% 4.950 3.465 N ARHGEF6 n/a
7 TRCN0000279990 GCTGAATGATTTGACTCAGTT pLKO_005 2498 3UTR 100% 4.950 3.465 N ARHGEF6 n/a
8 TRCN0000007403 GCCTGGAAGAAGAACTGAAAT pLKO.1 2326 CDS 100% 13.200 7.920 N ARHGEF6 n/a
9 TRCN0000280058 GCCTGGAAGAAGAACTGAAAT pLKO_005 2326 CDS 100% 13.200 7.920 N ARHGEF6 n/a
10 TRCN0000415811 GCTGAGGTGGGAGGATCATTT pLKO_005 3998 3UTR 100% 13.200 6.600 Y SULT1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11368 pDONR223 100% 66.9% 66.8% None 1_462del;662_742del;2158_2409del n/a
2 ccsbBroad304_11368 pLX_304 0% 66.9% 66.8% V5 1_462del;662_742del;2158_2409del n/a
3 TRCN0000481486 CTGCCTACAAACCATCTCCCTGGA pLX_317 29.9% 66.9% 66.8% V5 1_462del;662_742del;2158_2409del n/a
Download CSV