Transcript: Human XM_011531567.2

PREDICTED: Homo sapiens PR/SET domain 5 (PRDM5), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRDM5 (11107)
Length:
2020
CDS:
242..1873

Additional Resources:

NCBI RefSeq record:
XM_011531567.2
NBCI Gene record:
PRDM5 (11107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358512 GACCCTATAATTGCGAGATTT pLKO_005 1311 CDS 100% 13.200 18.480 N PRDM5 n/a
2 TRCN0000015259 GCGAGATTTGTAATAAGTCTT pLKO.1 1323 CDS 100% 4.950 6.930 N PRDM5 n/a
3 TRCN0000358511 ATCACTGCGATGCTACCTTTA pLKO_005 1578 CDS 100% 10.800 7.560 N PRDM5 n/a
4 TRCN0000015262 GCAAATTATGACAGTCATCAA pLKO.1 646 CDS 100% 4.950 3.465 N PRDM5 n/a
5 TRCN0000015260 GCTGCCATTCAAGAAGGAGAA pLKO.1 530 CDS 100% 4.050 2.835 N PRDM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11597 pDONR223 100% 78.1% 73.9% None (many diffs) n/a
2 ccsbBroad304_11597 pLX_304 0% 78.1% 73.9% V5 (many diffs) n/a
3 TRCN0000472094 ACGCCAGGCGGAGCATAACCGTCT pLX_317 26.5% 78.1% 73.9% V5 (many diffs) n/a
4 ccsbBroadEn_11596 pDONR223 100% 20.1% 18.2% None (many diffs) n/a
5 ccsbBroad304_11596 pLX_304 0% 20.1% 18.2% V5 (many diffs) n/a
6 TRCN0000467704 ACGTATTATTGTGGTACCCCGTCT pLX_317 100% 20.1% 18.2% V5 (many diffs) n/a
Download CSV