Transcript: Human XM_011531648.1

PREDICTED: Homo sapiens SH3 domain containing 19 (SH3D19), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3D19 (152503)
Length:
5247
CDS:
393..3437

Additional Resources:

NCBI RefSeq record:
XM_011531648.1
NBCI Gene record:
SH3D19 (152503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137187 GCTAGGATTCTACCGAGGAAA pLKO.1 3644 3UTR 100% 4.950 6.930 N SH3D19 n/a
2 TRCN0000430518 GTGTTGCTCGGTTTGAATATA pLKO_005 2791 CDS 100% 15.000 12.000 N SH3D19 n/a
3 TRCN0000429055 ATCACCTTGACTATCAGATAT pLKO_005 3484 3UTR 100% 13.200 9.240 N SH3D19 n/a
4 TRCN0000431942 CTGCAACCAGAAGATCTAATA pLKO_005 2122 CDS 100% 13.200 9.240 N SH3D19 n/a
5 TRCN0000414437 GAAACCAGATTGGCATATTTC pLKO_005 2677 CDS 100% 13.200 9.240 N SH3D19 n/a
6 TRCN0000168551 GCTTGAGCATATCAGCCTTAT pLKO.1 3904 3UTR 100% 10.800 7.560 N SH3D19 n/a
7 TRCN0000136062 GCAGAAGGATGAGTTGAGTTT pLKO.1 2819 CDS 100% 4.950 3.465 N SH3D19 n/a
8 TRCN0000167489 GCCAAATAGGTTGAAGACAAT pLKO.1 4609 3UTR 100% 4.950 3.465 N SH3D19 n/a
9 TRCN0000136972 CTTTCCTTCAAGGCTGGAGAT pLKO.1 3309 CDS 100% 4.050 2.835 N SH3D19 n/a
10 TRCN0000133635 GCCAATGAAGATATTGTCTCT pLKO.1 2328 CDS 100% 2.640 1.848 N SH3D19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10218 pDONR223 100% 75.3% 75.3% None 1_681del;1914_1982del n/a
2 ccsbBroad304_10218 pLX_304 0% 75.3% 75.3% V5 1_681del;1914_1982del n/a
3 TRCN0000471481 TCAATAGCTGAGAGTGAGCAAACA pLX_317 20.8% 75.3% 75.3% V5 1_681del;1914_1982del n/a
Download CSV