Transcript: Human XM_011532035.3

PREDICTED: Homo sapiens exosome component 9 (EXOSC9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOSC9 (5393)
Length:
1520
CDS:
101..1279

Additional Resources:

NCBI RefSeq record:
XM_011532035.3
NBCI Gene record:
EXOSC9 (5393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532035.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050882 GCAGAGTCTATAGCAAATCAA pLKO.1 953 CDS 100% 5.625 4.500 N EXOSC9 n/a
2 TRCN0000327852 GCAGAGTCTATAGCAAATCAA pLKO_005 953 CDS 100% 5.625 4.500 N EXOSC9 n/a
3 TRCN0000050881 CGTGTAGACCTACATTTATTA pLKO.1 497 CDS 100% 15.000 10.500 N EXOSC9 n/a
4 TRCN0000327926 CGTGTAGACCTACATTTATTA pLKO_005 497 CDS 100% 15.000 10.500 N EXOSC9 n/a
5 TRCN0000050878 GCTATCATTCTTGATGGTATA pLKO.1 1193 CDS 100% 10.800 7.560 N EXOSC9 n/a
6 TRCN0000327853 GCTATCATTCTTGATGGTATA pLKO_005 1193 CDS 100% 10.800 7.560 N EXOSC9 n/a
7 TRCN0000050879 GCTGGTGATTGCCATGAACAA pLKO.1 760 CDS 100% 4.950 3.465 N EXOSC9 n/a
8 TRCN0000363589 GCTGGTGATTGCCATGAACAA pLKO_005 760 CDS 100% 4.950 3.465 N EXOSC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532035.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06744 pDONR223 100% 88.7% 88.1% None (many diffs) n/a
2 ccsbBroad304_06744 pLX_304 0% 88.7% 88.1% V5 (many diffs) n/a
3 TRCN0000476300 GATTGACAGTGTAAACATATTTCC pLX_317 27.3% 88.7% 88.1% V5 (many diffs) n/a
Download CSV