Transcript: Human XM_011532499.1

PREDICTED: Homo sapiens cilia and flagella associated protein 36 (CFAP36), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP36 (112942)
Length:
1564
CDS:
924..1493

Additional Resources:

NCBI RefSeq record:
XM_011532499.1
NBCI Gene record:
CFAP36 (112942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137181 GCGAGCATTGAAGGACCAATA pLKO.1 1218 CDS 100% 10.800 7.560 N CFAP36 n/a
2 TRCN0000343460 GCGAGCATTGAAGGACCAATA pLKO_005 1218 CDS 100% 10.800 7.560 N CFAP36 n/a
3 TRCN0000134138 CAAGCAGAAGAGAGATAAGTT pLKO.1 1292 CDS 100% 5.625 3.938 N CFAP36 n/a
4 TRCN0000133983 CTTGAACACGAAGAGATGAAA pLKO.1 909 5UTR 100% 5.625 3.938 N CFAP36 n/a
5 TRCN0000343417 CTTGAACACGAAGAGATGAAA pLKO_005 909 5UTR 100% 5.625 3.938 N CFAP36 n/a
6 TRCN0000134072 GAGAAAGGATATGAGGACTAA pLKO.1 1322 CDS 100% 4.950 3.465 N CFAP36 n/a
7 TRCN0000343461 GAGAAAGGATATGAGGACTAA pLKO_005 1322 CDS 100% 4.950 3.465 N CFAP36 n/a
8 TRCN0000137262 GATGTGGTCAGTGACCTTGAA pLKO.1 894 5UTR 100% 4.950 3.465 N CFAP36 n/a
9 TRCN0000136179 GCAACGAGAACACTATCTCAA pLKO.1 1274 CDS 100% 4.950 3.465 N CFAP36 n/a
10 TRCN0000352921 GCAACGAGAACACTATCTCAA pLKO_005 1274 CDS 100% 4.950 3.465 N CFAP36 n/a
11 TRCN0000136122 GAAACCAGAAATGACAGCAGA pLKO.1 1403 CDS 100% 2.640 1.848 N CFAP36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09383 pDONR223 100% 55% 54.6% None 0_1ins459;269A>G;277A>T n/a
2 ccsbBroad304_09383 pLX_304 0% 55% 54.6% V5 0_1ins459;269A>G;277A>T n/a
3 TRCN0000467508 ACTTGTTACGTTATGCCGCGTAAC pLX_317 38.3% 55% 54.6% V5 0_1ins459;269A>G;277A>T n/a
Download CSV