Transcript: Human XM_011532660.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 6 (DNAH6), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH6 (1768)
Length:
7073
CDS:
138..6965

Additional Resources:

NCBI RefSeq record:
XM_011532660.1
NBCI Gene record:
DNAH6 (1768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168637 GCCATTATCTTTGAGGCACAA pLKO.1 2259 CDS 100% 4.050 2.835 N DNAH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10785 pDONR223 100% 17.8% 17.8% None (many diffs) n/a
2 ccsbBroad304_10785 pLX_304 0% 17.8% 17.8% V5 (many diffs) n/a
3 TRCN0000480563 AAGCCTACTAACCAGATTTTATTC pLX_317 32% 17.8% 17.8% V5 (many diffs) n/a
4 ccsbBroadEn_10784 pDONR223 100% 11.4% 10.7% None (many diffs) n/a
5 ccsbBroad304_10784 pLX_304 0% 11.4% 10.7% V5 (many diffs) n/a
Download CSV