Transcript: Human XM_011532907.2

PREDICTED: Homo sapiens ATPase H+ transporting V1 subunit B1 (ATP6V1B1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP6V1B1 (525)
Length:
2151
CDS:
180..1841

Additional Resources:

NCBI RefSeq record:
XM_011532907.2
NBCI Gene record:
ATP6V1B1 (525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431334 GGAAGACCACTTGCGAATTTA pLKO_005 604 CDS 100% 15.000 21.000 N ATP6V1B1 n/a
2 TRCN0000029552 GCCGAGGGTTTCCTGGATATA pLKO.1 1240 CDS 100% 13.200 18.480 N ATP6V1B1 n/a
3 TRCN0000029551 GCCGTGATCGACGAGTTCTAT pLKO.1 1773 CDS 100% 5.625 7.875 N ATP6V1B1 n/a
4 TRCN0000029549 GCGATTGTTCAGGTGTTTGAA pLKO.1 561 CDS 100% 5.625 7.875 N ATP6V1B1 n/a
5 TRCN0000424637 CATGCCCAACGACGATATCAC pLKO_005 1346 CDS 100% 4.950 6.930 N ATP6V1B1 n/a
6 TRCN0000418780 TGGTCATACTGACGGACATGA pLKO_005 1162 CDS 100% 4.950 6.930 N ATP6V1B1 n/a
7 TRCN0000029550 GCTGGATTACCATGACGACAA pLKO.1 938 CDS 100% 4.050 2.835 N ATP6V1B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05872 pDONR223 100% 88.7% 84.4% None (many diffs) n/a
2 ccsbBroad304_05872 pLX_304 0% 88.7% 84.4% V5 (many diffs) n/a
3 TRCN0000479148 TGTTTATACTCTGTAATTGCCTAG pLX_317 29.8% 88.7% 84.4% V5 (many diffs) n/a
4 ccsbBroadEn_15365 pDONR223 0% 43.9% 39.4% None (many diffs) n/a
Download CSV