Transcript: Human XM_011532946.2

PREDICTED: Homo sapiens S1 RNA binding domain 1 (SRBD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRBD1 (55133)
Length:
3646
CDS:
77..3016

Additional Resources:

NCBI RefSeq record:
XM_011532946.2
NBCI Gene record:
SRBD1 (55133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294428 TTCCTTTAAACGCCTTATTTA pLKO_005 1549 CDS 100% 15.000 21.000 N SRBD1 n/a
2 TRCN0000048764 GCAGACGTTGAGGTCACAAAT pLKO.1 2414 CDS 100% 13.200 18.480 N SRBD1 n/a
3 TRCN0000294430 CTTTGTGGGAGTGGATATTAA pLKO_005 2140 CDS 100% 15.000 12.000 N SRBD1 n/a
4 TRCN0000048766 CCAGAGTTAATGAAGATCTTA pLKO.1 1511 CDS 100% 5.625 4.500 N SRBD1 n/a
5 TRCN0000048765 CCCATACGAAATGTAACAGAA pLKO.1 2867 CDS 100% 4.950 3.960 N SRBD1 n/a
6 TRCN0000294497 TCCCTTCATTATACGTTATAG pLKO_005 802 CDS 100% 13.200 9.240 N SRBD1 n/a
7 TRCN0000048763 GCCAACATCATTCGTCTCTTT pLKO.1 764 CDS 100% 4.950 3.465 N SRBD1 n/a
8 TRCN0000290637 GCCAACATCATTCGTCTCTTT pLKO_005 764 CDS 100% 4.950 3.465 N SRBD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12167 pDONR223 100% 60.3% 59.6% None (many diffs) n/a
2 ccsbBroad304_12167 pLX_304 0% 60.3% 59.6% V5 (many diffs) n/a
3 TRCN0000470281 CGAAGGTCCAAGCGTTTCTTACAA pLX_317 18.7% 60.3% 59.6% V5 (many diffs) n/a
Download CSV