Transcript: Human XM_011533013.2

PREDICTED: Homo sapiens ATP/GTP binding protein like 5 (AGBL5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGBL5 (60509)
Length:
2847
CDS:
187..2847

Additional Resources:

NCBI RefSeq record:
XM_011533013.2
NBCI Gene record:
AGBL5 (60509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294173 CCCGTCTAGAGCAGCTATTTC pLKO_005 851 CDS 100% 13.200 18.480 N AGBL5 n/a
2 TRCN0000294232 TTCGCAGGCAAGAGGATATTC pLKO_005 901 CDS 100% 13.200 18.480 N AGBL5 n/a
3 TRCN0000073889 GCTGTCATGGTAATCGGGAAA pLKO.1 2470 CDS 100% 4.050 5.670 N AGBL5 n/a
4 TRCN0000286772 GCTGTCATGGTAATCGGGAAA pLKO_005 2470 CDS 100% 4.050 5.670 N AGBL5 n/a
5 TRCN0000073890 GCTTACTATGTGGACCTGCAT pLKO.1 1468 CDS 100% 2.640 3.696 N AGBL5 n/a
6 TRCN0000031387 CCAAAGCTCATCTCCTTGAAT pLKO.1 1570 CDS 100% 5.625 3.938 N Agbl5 n/a
7 TRCN0000073891 CTCTTCGTCTTTAAGCTGATT pLKO.1 1033 CDS 100% 4.950 3.465 N AGBL5 n/a
8 TRCN0000073892 CCTCTTCGTCTTTAAGCTGAT pLKO.1 1032 CDS 100% 4.050 2.835 N AGBL5 n/a
9 TRCN0000286850 CCTCTTCGTCTTTAAGCTGAT pLKO_005 1032 CDS 100% 4.050 2.835 N AGBL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12427 pDONR223 100% 78.5% 78.1% None 1_276del;2352_2353ins47;2402_2658del n/a
2 ccsbBroad304_12427 pLX_304 0% 78.5% 78.1% V5 1_276del;2352_2353ins47;2402_2658del n/a
3 TRCN0000478467 TCTGTTTAATGATTCCTATCTCTC pLX_317 14.5% 78.5% 78.1% V5 1_276del;2352_2353ins47;2402_2658del n/a
Download CSV