Transcript: Human XM_011533554.2

PREDICTED: Homo sapiens leucyl-tRNA synthetase 2, mitochondrial (LARS2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LARS2 (23395)
Length:
3510
CDS:
205..2697

Additional Resources:

NCBI RefSeq record:
XM_011533554.2
NBCI Gene record:
LARS2 (23395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417129 AGGAGGTCCCTGTCGTTATTT pLKO_005 1265 CDS 100% 15.000 21.000 N LARS2 n/a
2 TRCN0000045889 GCCGTCATGCACTTGTTCTAT pLKO.1 1894 CDS 100% 5.625 4.500 N LARS2 n/a
3 TRCN0000415985 ACCTTGACAACTCGGTTTATT pLKO_005 2293 CDS 100% 15.000 10.500 N LARS2 n/a
4 TRCN0000045888 CCTCAGACAATGGTTTATTAA pLKO.1 915 CDS 100% 15.000 10.500 N LARS2 n/a
5 TRCN0000045891 GCCTACTCTGAAGTCATTGAA pLKO.1 1381 CDS 100% 5.625 3.938 N LARS2 n/a
6 TRCN0000045892 CCCTCATGTAACCTCAGAGAT pLKO.1 2580 CDS 100% 4.950 3.465 N LARS2 n/a
7 TRCN0000045890 CGGATGTACCAGAAGCATCTA pLKO.1 306 CDS 100% 4.950 3.465 N LARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07876 pDONR223 100% 90.7% 87.7% None (many diffs) n/a
2 ccsbBroad304_07876 pLX_304 0% 90.7% 87.7% V5 (many diffs) n/a
3 TRCN0000480082 TACTTTCGGATAGACCTTCCAGAA pLX_317 16.3% 90.7% 87.7% V5 (many diffs) n/a
Download CSV