Transcript: Human XM_011533585.3

PREDICTED: Homo sapiens forkhead box P1 (FOXP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOXP1 (27086)
Length:
6058
CDS:
671..2704

Additional Resources:

NCBI RefSeq record:
XM_011533585.3
NBCI Gene record:
FOXP1 (27086)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015663 CGCAGAAGTTAGACCACCATT pLKO.1 2053 CDS 100% 4.950 6.930 N FOXP1 n/a
2 TRCN0000015664 GCAGCAAGTTAGTGGATTAAA pLKO.1 895 CDS 100% 15.000 10.500 N FOXP1 n/a
3 TRCN0000244819 GCAGCAAGTTAGTGGATTAAA pLKO_005 895 CDS 100% 15.000 10.500 N FOXP1 n/a
4 TRCN0000321629 GCAGCAAGTTAGTGGATTAAA pLKO_005 895 CDS 100% 15.000 10.500 N Foxp1 n/a
5 TRCN0000244822 TGGTAACCCTTCCCTTATTAA pLKO_005 2320 CDS 100% 15.000 10.500 N FOXP1 n/a
6 TRCN0000321565 TGGTAACCCTTCCCTTATTAA pLKO_005 2320 CDS 100% 15.000 10.500 N Foxp1 n/a
7 TRCN0000244821 AGCCCAATGTAGAGTACAAAT pLKO_005 1684 CDS 100% 13.200 9.240 N FOXP1 n/a
8 TRCN0000015665 GCCCATTTCGTCAGCAGATAT pLKO.1 2005 CDS 100% 13.200 9.240 N FOXP1 n/a
9 TRCN0000244823 TGCAATTAGAGTATCCAATAA pLKO_005 4811 3UTR 100% 13.200 9.240 N FOXP1 n/a
10 TRCN0000244820 TGCGAAGATTTCCAATCATTT pLKO_005 1619 CDS 100% 13.200 9.240 N FOXP1 n/a
11 TRCN0000015666 GTGCGAAGATTTCCAATCATT pLKO.1 1618 CDS 100% 5.625 3.938 N FOXP1 n/a
12 TRCN0000015667 CAGGCTTCAATGGCTGAGAAT pLKO.1 2390 CDS 100% 4.950 3.465 N FOXP1 n/a
13 TRCN0000072006 GCTTACCTCATACTCCAACAA pLKO.1 1875 CDS 100% 4.950 3.960 N Foxp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02991 pDONR223 100% 13.1% 10.9% None (many diffs) n/a
2 ccsbBroad304_02991 pLX_304 0% 13.1% 10.9% V5 (many diffs) n/a
3 TRCN0000473473 TCAAAACGGTCCGAGTCCCTACCG pLX_317 97.7% 13.1% 10.9% V5 (many diffs) n/a
Download CSV