Transcript: Human XM_011534091.2

PREDICTED: Homo sapiens Wnt family member 7A (WNT7A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WNT7A (7476)
Length:
1938
CDS:
254..1102

Additional Resources:

NCBI RefSeq record:
XM_011534091.2
NBCI Gene record:
WNT7A (7476)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062110 CATAGGAGAAGGCTCACAAAT pLKO.1 235 5UTR 100% 13.200 18.480 N WNT7A n/a
2 TRCN0000442057 GGCGCAAGCATCATCTGTAAC pLKO_005 149 5UTR 100% 10.800 15.120 N WNT7A n/a
3 TRCN0000441773 TCTTCGGGAAGGAGCTCAAAG pLKO_005 327 CDS 100% 10.800 7.560 N WNT7A n/a
4 TRCN0000062109 GCGTTCACCTACGCCATCATT pLKO.1 365 CDS 100% 5.625 3.938 N WNT7A n/a
5 TRCN0000062108 CGTGCTCAAGGACAAGTACAA pLKO.1 730 CDS 100% 4.950 3.465 N WNT7A n/a
6 TRCN0000438213 ACGGAGATGTACACGTGCAAG pLKO_005 1079 CDS 100% 4.050 2.835 N WNT7A n/a
7 TRCN0000062112 GATCAAGAAGCCACTGTCGTA pLKO.1 811 CDS 100% 2.640 1.848 N WNT7A n/a
8 TRCN0000062111 CCCGACGCCATCATCGTCATA pLKO.1 218 5UTR 100% 1.650 1.155 N WNT7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01780 pDONR223 100% 80.8% 80.8% None 0_1ins201 n/a
2 ccsbBroad304_01780 pLX_304 0% 80.8% 80.8% V5 0_1ins201 n/a
3 TRCN0000471010 GACCGGAGCCCCTCAGTGTGATTG pLX_317 28.8% 80.8% 80.8% V5 0_1ins201 n/a
Download CSV