Transcript: Human XM_011534307.2

PREDICTED: Homo sapiens IQ motif and Sec7 domain ArfGEF 1 (IQSEC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQSEC1 (9922)
Length:
7549
CDS:
397..3786

Additional Resources:

NCBI RefSeq record:
XM_011534307.2
NBCI Gene record:
IQSEC1 (9922)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433403 ACTACTCAGACGGTGACAATG pLKO_005 1790 CDS 100% 10.800 15.120 N IQSEC1 n/a
2 TRCN0000149750 GATCTATGAACGGATCCGTAA pLKO.1 2505 CDS 100% 4.050 5.670 N IQSEC1 n/a
3 TRCN0000419378 CCTTCTCTAGGCAAGTGAAAT pLKO_005 1124 CDS 100% 13.200 10.560 N IQSEC1 n/a
4 TRCN0000428512 AGATGCTAGAACGAAAGTATG pLKO_005 764 CDS 100% 10.800 7.560 N IQSEC1 n/a
5 TRCN0000180095 CTTTGAGGTTCCAGACCCAAA pLKO.1 2676 CDS 100% 4.050 2.835 N IQSEC1 n/a
6 TRCN0000148977 GAAGAAATTCACCGATGACCT pLKO.1 2949 CDS 100% 2.640 1.848 N IQSEC1 n/a
7 TRCN0000149784 CCAGTACCAGATGAACAAGAA pLKO.1 837 CDS 100% 4.950 2.970 N IQSEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14033 pDONR223 100% 72% 71.7% None (many diffs) n/a
2 ccsbBroad304_14033 pLX_304 0% 72% 71.7% V5 (many diffs) n/a
3 TRCN0000481156 GCCGTCTCGGCATATTACACGAAA pLX_317 15.3% 72% 71.7% V5 (many diffs) n/a
Download CSV