Transcript: Human XM_011534376.3

PREDICTED: Homo sapiens sec1 family domain containing 2 (SCFD2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCFD2 (152579)
Length:
2044
CDS:
113..1681

Additional Resources:

NCBI RefSeq record:
XM_011534376.3
NBCI Gene record:
SCFD2 (152579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159653 GCAATGTCCGTTGTGTTAAAT pLKO.1 1439 CDS 100% 15.000 21.000 N SCFD2 n/a
2 TRCN0000163071 CGCAGTCACTTCCAGTATTGT pLKO.1 395 CDS 100% 5.625 4.500 N SCFD2 n/a
3 TRCN0000198048 CTCAGTTCTCTGTGTGAACAT pLKO.1 779 CDS 100% 4.950 3.465 N Scfd2 n/a
4 TRCN0000164508 CTTTGCCTTGACTCCAGCTTT pLKO.1 610 CDS 100% 4.950 3.465 N SCFD2 n/a
5 TRCN0000163244 GTCAGCAATGTCCGTTGTGTT pLKO.1 1435 CDS 100% 4.950 3.465 N SCFD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09688 pDONR223 100% 76.2% 76% None 1458G>A;1561_1562ins22;1566_1567ins464 n/a
2 ccsbBroad304_09688 pLX_304 0% 76.2% 76% V5 1458G>A;1561_1562ins22;1566_1567ins464 n/a
3 TRCN0000476080 TACCGGACCTGCCAAGGTCGGAAT pLX_317 17% 76.2% 76% V5 1458G>A;1561_1562ins22;1566_1567ins464 n/a
Download CSV