Transcript: Human XM_011534941.2

PREDICTED: Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DACH1 (1602)
Length:
6087
CDS:
1300..2439

Additional Resources:

NCBI RefSeq record:
XM_011534941.2
NBCI Gene record:
DACH1 (1602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294328 TCATGTCTCCTGGGATAATTC pLKO_005 2234 CDS 100% 13.200 9.240 N DACH1 n/a
2 TRCN0000085973 CCCAGAGAACTCTCACATCAT pLKO.1 2193 CDS 100% 4.950 3.465 N Dach1 n/a
3 TRCN0000085975 GAGCAACTATCATGCCAGTAA pLKO.1 2355 CDS 100% 4.950 3.465 N Dach1 n/a
4 TRCN0000118090 ACTCTCACATCATGCCGCATT pLKO.1 2201 CDS 100% 4.050 2.835 N DACH1 n/a
5 TRCN0000085976 CCTCTACAATGACTGCACCAA pLKO.1 2121 CDS 100% 2.640 1.848 N Dach1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13842 pDONR223 100% 26.7% 4.4% None (many diffs) n/a
2 ccsbBroad304_13842 pLX_304 0% 26.7% 4.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474576 CCGCATCAATTTCGCCTCTGTCTC pLX_317 17.9% 26.7% 4.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV