Transcript: Human XM_011534978.2

PREDICTED: Homo sapiens family with sequence similarity 124 member A (FAM124A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM124A (220108)
Length:
4926
CDS:
132..1151

Additional Resources:

NCBI RefSeq record:
XM_011534978.2
NBCI Gene record:
FAM124A (220108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167457 GTGCATAAGAAGTTTCCTAAA pLKO.1 1144 CDS 100% 10.800 15.120 N FAM124A n/a
2 TRCN0000263906 ACTGTACACACGGTGACAAAG pLKO_005 274 CDS 100% 10.800 8.640 N FAM124A n/a
3 TRCN0000172871 GAAAGCGGACTTCTGCATCTT pLKO.1 842 CDS 100% 4.950 3.960 N FAM124A n/a
4 TRCN0000263904 TGTCTGTGGTCTCTGCATATT pLKO_005 1574 3UTR 100% 13.200 9.240 N FAM124A n/a
5 TRCN0000263905 CTCTGCTCTTGTTCTCGAAAC pLKO_005 1947 3UTR 100% 6.000 4.200 N FAM124A n/a
6 TRCN0000263902 TCCTCTCCATCGATGACCTAG pLKO_005 1499 3UTR 100% 4.050 2.835 N FAM124A n/a
7 TRCN0000168134 CGAAACACACAAACTCAGAGA pLKO.1 1962 3UTR 100% 2.640 1.848 N FAM124A n/a
8 TRCN0000263903 GAGCCTCCAGGTTGAACATAC pLKO_005 308 CDS 100% 10.800 6.480 N FAM124A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16126 pDONR223 0% 83.1% 82.1% None (many diffs) n/a
2 ccsbBroad304_16126 pLX_304 0% 83.1% 82.1% V5 (many diffs) n/a
3 ccsbBroadEn_13412 pDONR223 100% 50.3% 47.8% None (many diffs) n/a
4 ccsbBroad304_13412 pLX_304 0% 50.3% 47.8% V5 (many diffs) n/a
5 TRCN0000472164 CTGCAGGGATGTGGGGGCACAATT pLX_317 27.2% 50.3% 47.8% V5 (many diffs) n/a
Download CSV